EMAIL THIS PAGE TO A FRIEND

CYBA

cytochrome b-245, alpha polypeptide

47 Gene Product Result for
Synonyms: p22-PHOX
UniProtKB ID: P13498, Q14090, Q9BR72
Gene ID:
Human(1535) Summary: Cytochrome b is comprised of a light chain (alpha) and a heavy chain (beta). This gene encodes the light, alpha subunit which has been proposed as a primary component of the microbicidal oxidase system of phagocytes. Mutations in this gene are associated with autosomal recessive chronic granulomatous disease (CGD), that is characterized by the failure of activated phagocytes to generate superoxide, which is important for the microbicidal activity of these cells. [provided by RefSeq, Jul 2008]
Mouse(13057) cytochrome b-245, alpha polypeptide
Rat(79129) cytochrome b-245, alpha polypeptide
Zebrafish(393551) cytochrome b-245, alpha polypeptide
cow(281111) cytochrome b-245, alpha polypeptide
dog(489664) cytochrome b-245, alpha polypeptide
domestic guinea pig(100732048) cytochrome b-245, alpha polypeptide
sheep(100135693) cytochrome b-245, alpha polypeptide
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000101 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000101 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000101 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007806 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007806 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007806 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU015681 MISSION® esiRNA esiRNA targeting mouse Cyba (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000101 Rosetta Predictions human pricing
NM_024160 Rosetta Predictions rat pricing
NM_007806 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000101 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204558 predicted 270
2 SASI_Hs01_00204559 predicted 271
3 SASI_Hs01_00204560 predicted 250
4 SASI_Hs01_00204561 predicted 273
5 SASI_Hs01_00204562 predicted 274
6 SASI_Hs01_00204563 predicted 265
7 SASI_Hs01_00204565 predicted 270
8 SASI_Hs01_00204566 predicted 247
9 SASI_Hs01_00204567 predicted 246
10 SASI_Hs02_00301872 predicted 246
11 SASI_Hs01_00204564 predicted 262
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024160 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052393 predicted 440
2 SASI_Rn01_00052394 predicted 303
3 SASI_Rn01_00052395 predicted 240
4 SASI_Rn01_00052396 predicted 307
5 SASI_Rn01_00052397 predicted 435
6 SASI_Rn01_00052398 predicted 255
7 SASI_Rn01_00052399 predicted 306
8 SASI_Rn01_00052400 predicted 387
9 SASI_Rn01_00052401 predicted 433
10 SASI_Rn01_00052402 predicted 308
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007806 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116993 predicted 266
2 SASI_Mm02_00312510 predicted 289
3 SASI_Mm01_00116997 predicted 252
4 SASI_Mm01_00116998 predicted 399
5 SASI_Mm02_00312511 predicted 414
6 SASI_Mm02_00312512 predicted 198
7 SASI_Mm02_00312513 predicted 200
8 SASI_Mm01_00116990 predicted 468
9 SASI_Mm01_00116991 predicted 266
10 SASI_Mm01_00116992 predicted 413
11 SASI_Mm01_00116994 predicted 401
12 SASI_Mm01_00116995 predicted 406
13 SASI_Mm01_00116996 predicted 448
14 SASI_Mm01_00116999 predicted 248
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000101
VALIDATED
CYBA MISSION shRNA Bacterial Glycerol Stock
cytochrome b-245, alpha polypeptide
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_000101.2-249s21c1
Sequence:CCGGGTACATGACCGCCGTGGTGAACTCGAGTTCACCACGGCGGTCATGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000101.2-375s21c1
Sequence:CCGGCCTGGCCATTGCGAGCGGCATCTCGAGATGCCGCTCGCAATGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_000101.2-138s21c1
Sequence:CCGGCCAGTGGTACTTTGGTGCCTACTCGAGTAGGCACCAAAGTACCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_000101.2-279s21c1
Sequence:CCGGGCCCTTTACCAGGAATTACTACTCGAGTAGTAATTCCTGGTAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000101.2-130s21c1
Sequence:CCGGCGCTTCACCCAGTGGTACTTTCTCGAGAAAGTACCACTGGGTGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000101.2-211s21c1
Sequence:CCGGAGGAAGAAGGGCTCCACCATGCTCGAGCATGGTGGAGCCCTTCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_000101.1-271s1c1
Sequence:CCGGGCCCTTTACCAGGAATTACTACTCGAGTAGTAATTCCTGGTAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000101.1-130s1c1
Sequence:CCGGCCAGTGGTACTTTGGTGCCTACTCGAGTAGGCACCAAAGTACCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000101.1-122s1c1
Sequence:CCGGCGCTTCACCCAGTGGTACTTTCTCGAGAAAGTACCACTGGGTGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000101.1-367s1c1
Sequence:CCGGCCTGGCCATTGCGAGCGGCATCTCGAGATGCCGCTCGCAATGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000101.1-451s1c1
Sequence:CCGGGCCGCAGATCGGAGGCACCATCTCGAGATGGTGCCTCCGATCTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000101
VALIDATED
CYBA MISSION shRNA shRNA Plasmid DNA
cytochrome b-245, alpha polypeptide
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_000101.2-249s21c1
Sequence:CCGGGTACATGACCGCCGTGGTGAACTCGAGTTCACCACGGCGGTCATGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000101.2-375s21c1
Sequence:CCGGCCTGGCCATTGCGAGCGGCATCTCGAGATGCCGCTCGCAATGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_000101.2-138s21c1
Sequence:CCGGCCAGTGGTACTTTGGTGCCTACTCGAGTAGGCACCAAAGTACCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_000101.2-279s21c1
Sequence:CCGGGCCCTTTACCAGGAATTACTACTCGAGTAGTAATTCCTGGTAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000101.2-130s21c1
Sequence:CCGGCGCTTCACCCAGTGGTACTTTCTCGAGAAAGTACCACTGGGTGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000101.2-211s21c1
Sequence:CCGGAGGAAGAAGGGCTCCACCATGCTCGAGCATGGTGGAGCCCTTCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_000101.1-271s1c1
Sequence:CCGGGCCCTTTACCAGGAATTACTACTCGAGTAGTAATTCCTGGTAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000101.1-130s1c1
Sequence:CCGGCCAGTGGTACTTTGGTGCCTACTCGAGTAGGCACCAAAGTACCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000101.1-122s1c1
Sequence:CCGGCGCTTCACCCAGTGGTACTTTCTCGAGAAAGTACCACTGGGTGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000101.1-367s1c1
Sequence:CCGGCCTGGCCATTGCGAGCGGCATCTCGAGATGCCGCTCGCAATGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000101.1-451s1c1
Sequence:CCGGGCCGCAGATCGGAGGCACCATCTCGAGATGGTGCCTCCGATCTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000101
VALIDATED
CYBA MISSION shRNA Lentiviral Transduction Particles
cytochrome b-245, alpha polypeptide
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_000101.2-249s21c1
Sequence:CCGGGTACATGACCGCCGTGGTGAACTCGAGTTCACCACGGCGGTCATGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000101.2-375s21c1
Sequence:CCGGCCTGGCCATTGCGAGCGGCATCTCGAGATGCCGCTCGCAATGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_000101.2-138s21c1
Sequence:CCGGCCAGTGGTACTTTGGTGCCTACTCGAGTAGGCACCAAAGTACCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_000101.2-279s21c1
Sequence:CCGGGCCCTTTACCAGGAATTACTACTCGAGTAGTAATTCCTGGTAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000101.2-130s21c1
Sequence:CCGGCGCTTCACCCAGTGGTACTTTCTCGAGAAAGTACCACTGGGTGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000101.2-211s21c1
Sequence:CCGGAGGAAGAAGGGCTCCACCATGCTCGAGCATGGTGGAGCCCTTCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_000101.1-271s1c1
Sequence:CCGGGCCCTTTACCAGGAATTACTACTCGAGTAGTAATTCCTGGTAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000101.1-130s1c1
Sequence:CCGGCCAGTGGTACTTTGGTGCCTACTCGAGTAGGCACCAAAGTACCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000101.1-122s1c1
Sequence:CCGGCGCTTCACCCAGTGGTACTTTCTCGAGAAAGTACCACTGGGTGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000101.1-367s1c1
Sequence:CCGGCCTGGCCATTGCGAGCGGCATCTCGAGATGCCGCTCGCAATGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000101.1-451s1c1
Sequence:CCGGGCCGCAGATCGGAGGCACCATCTCGAGATGGTGCCTCCGATCTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007806
VALIDATED
CYBA MISSION shRNA Bacterial Glycerol Stock
cytochrome b-245, alpha polypeptide
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007806.3-417s21c1
Sequence:CCGGCCATTGCCAGTGTGATCTATCCTCGAGGATAGATCACACTGGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007806.3-515s21c1
Sequence:CCGGATCAAGCAACCACCTACCAACCTCGAGGTTGGTAGGTGGTTGCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007806.3-269s21c1
Sequence:CCGGGAGCGATGTGGACAGAAGTACCTCGAGGTACTTCTGTCCACATCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217794    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007806.3-167s1c1
Sequence:CCGGCGTTTCACACAGTGGTATTTCCTCGAGGAAATACCACTGTGTGAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007806.3-167s21c1
Sequence:CCGGCGTTTCACACAGTGGTATTTCCTCGAGGAAATACCACTGTGTGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007806.3-464s21c1
Sequence:CCGGTGGACTCCCATTGAGCCTAAACTCGAGTTTAGGCTCAATGGGAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184095    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007806.1-502s1c1
Sequence:CCGGCATCAAGCAACCACCTACCAACTCGAGTTGGTAGGTGGTTGCTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195878    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007806.1-308s1c1
Sequence:CCGGCTCACCAGGAATTACTACGTCCTCGAGGACGTAGTAATTCCTGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007806
VALIDATED
CYBA MISSION shRNA shRNA Plasmid DNA
cytochrome b-245, alpha polypeptide
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007806.3-417s21c1
Sequence:CCGGCCATTGCCAGTGTGATCTATCCTCGAGGATAGATCACACTGGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007806.3-515s21c1
Sequence:CCGGATCAAGCAACCACCTACCAACCTCGAGGTTGGTAGGTGGTTGCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007806.3-269s21c1
Sequence:CCGGGAGCGATGTGGACAGAAGTACCTCGAGGTACTTCTGTCCACATCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217794    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007806.3-167s1c1
Sequence:CCGGCGTTTCACACAGTGGTATTTCCTCGAGGAAATACCACTGTGTGAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007806.3-167s21c1
Sequence:CCGGCGTTTCACACAGTGGTATTTCCTCGAGGAAATACCACTGTGTGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007806.3-464s21c1
Sequence:CCGGTGGACTCCCATTGAGCCTAAACTCGAGTTTAGGCTCAATGGGAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184095    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007806.1-502s1c1
Sequence:CCGGCATCAAGCAACCACCTACCAACTCGAGTTGGTAGGTGGTTGCTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195878    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007806.1-308s1c1
Sequence:CCGGCTCACCAGGAATTACTACGTCCTCGAGGACGTAGTAATTCCTGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007806
VALIDATED
CYBA MISSION shRNA Lentiviral Transduction Particles
cytochrome b-245, alpha polypeptide
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007806.3-417s21c1
Sequence:CCGGCCATTGCCAGTGTGATCTATCCTCGAGGATAGATCACACTGGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007806.3-515s21c1
Sequence:CCGGATCAAGCAACCACCTACCAACCTCGAGGTTGGTAGGTGGTTGCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007806.3-269s21c1
Sequence:CCGGGAGCGATGTGGACAGAAGTACCTCGAGGTACTTCTGTCCACATCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217794    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007806.3-167s1c1
Sequence:CCGGCGTTTCACACAGTGGTATTTCCTCGAGGAAATACCACTGTGTGAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007806.3-167s21c1
Sequence:CCGGCGTTTCACACAGTGGTATTTCCTCGAGGAAATACCACTGTGTGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007806.3-464s21c1
Sequence:CCGGTGGACTCCCATTGAGCCTAAACTCGAGTTTAGGCTCAATGGGAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184095    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007806.1-502s1c1
Sequence:CCGGCATCAAGCAACCACCTACCAACTCGAGTTGGTAGGTGGTTGCTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195878    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007806.1-308s1c1
Sequence:CCGGCTCACCAGGAATTACTACGTCCTCGAGGACGTAGTAATTCCTGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks