EMAIL THIS PAGE TO A FRIEND

CYBB

cytochrome b-245, beta polypeptide

184 Gene Product Result for
Synonyms: AMCBX2 CGD GP91-1 GP91-PHOX GP91PHOX NOX2 p91-PHOX
UniProtKB ID: P04839, A8K138, Q2PP16
Gene ID:
Human(1536) Summary: Cytochrome b (-245) is composed of cytochrome b alpha (CYBA) and beta (CYBB) chain. It has been proposed as a primary component of the microbicidal oxidase system of phagocytes. CYBB deficiency is one of five described biochemical defects associated with chronic granulomatous disease (CGD). In this disorder, there is decreased activity of phagocyte NADPH oxidase; neutrophils are able to phagocytize bacteria but cannot kill them in the phagocytic vacuoles. The cause of the killing defect is an inability to increase the cell's respiration and consequent failure to deliver activated oxygen into the phagocytic vacuole. [provided by RefSeq, Jul 2008]
Mouse(13058) cytochrome b-245, beta polypeptide
Rat(66021) cytochrome b-245, beta polypeptide
Zebrafish(393386) cytochrome b-245, beta polypeptide (chronic granulomatous disease)
chicken(418581) cytochrome b-245, beta polypeptide
cow(281112) cytochrome b-245, beta polypeptide
dog(491825) cytochrome b-245, beta polypeptide (chronic granulomatous disease)
sheep(100036757) cytochrome b-245, beta polypeptide
Domestic Rabbit(100008801) cytochrome b-245 beta polypeptide
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000397 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000397 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000397 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007807 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007807 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007807 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU010941 MISSION® esiRNA esiRNA targeting human CYBB (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000397 Rosetta Predictions human pricing
NM_023965 Rosetta Predictions rat pricing
NM_007807 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000397 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086110 predicted 856
2 SASI_Hs01_00086111 predicted 856
3 SASI_Hs01_00086112 predicted 452
4 SASI_Hs01_00086113 predicted 1303
5 SASI_Hs01_00086114 predicted 1584
6 SASI_Hs01_00086116 predicted 391
7 SASI_Hs01_00086117 predicted 1258
8 SASI_Hs01_00086118 predicted 1640
9 SASI_Hs01_00086119 predicted 366
10 SASI_Hs02_00302471 predicted 1153
11 SASI_Hs01_00086115 predicted 1309
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023965 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113372 predicted 531
2 SASI_Rn01_00113373 predicted 1130
3 SASI_Rn01_00113374 predicted 1192
4 SASI_Rn01_00113375 predicted 792
5 SASI_Rn01_00113377 predicted 1400
6 SASI_Rn02_00263774 predicted 789
7 SASI_Rn01_00113378 predicted 769
8 SASI_Rn01_00113379 predicted 656
9 SASI_Rn01_00113380 predicted 705
10 SASI_Rn01_00113381 predicted 1108
11 SASI_Rn01_00113376 predicted 531
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007807 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312514 predicted 866
2 SASI_Mm01_00160872 predicted 895
3 SASI_Mm01_00160873 predicted 517
4 SASI_Mm01_00160874 predicted 1269
5 SASI_Mm01_00160875 predicted 1505
6 SASI_Mm01_00160876 predicted 985
7 SASI_Mm01_00160877 predicted 1830
8 SASI_Mm01_00160878 predicted 770
9 SASI_Mm01_00160880 predicted 418
10 SASI_Mm01_00160881 predicted 848
11 SASI_Mm01_00160879 predicted 1013
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000397
CYBB MISSION shRNA Bacterial Glycerol Stock
cytochrome b-245, beta polypeptide
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000397.2-399s1c1
Sequence:CCGGGCCCGAGTCAATAATTCTGATCTCGAGATCAGAATTATTGACTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000397.2-1637s1c1
Sequence:CCGGCTTGGCTGAAACCCTGAGTAACTCGAGTTACTCAGGGTTTCAGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000397.2-1158s1c1
Sequence:CCGGCTACCTAAGATAGCGGTTGATCTCGAGATCAACCGCTATCTTAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000397.2-813s1c1
Sequence:CCGGCCTATGACTTGGAAATGGATACTCGAGTATCCATTTCCAAGTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000397.2-93s1c1
Sequence:CCGGGTCTGGTATTACCGGGTTTATCTCGAGATAAACCCGGTAATACCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000397.3-605s21c1
Sequence:CCGGATCACGCTGTGCCTCATATTACTCGAGTAATATGAGGCACAGCGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000397.3-2212s21c1
Sequence:CCGGGAAACCAAGGAGTAGCTATATCTCGAGATATAGCTACTCCTTGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000397.3-723s21c1
Sequence:CCGGTCCATGGAGCTGAACGAATTGCTCGAGCAATTCGTTCAGCTCCATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000397
CYBB MISSION shRNA shRNA Plasmid DNA
cytochrome b-245, beta polypeptide
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000397.2-399s1c1
Sequence:CCGGGCCCGAGTCAATAATTCTGATCTCGAGATCAGAATTATTGACTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000397.2-1637s1c1
Sequence:CCGGCTTGGCTGAAACCCTGAGTAACTCGAGTTACTCAGGGTTTCAGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000397.2-1158s1c1
Sequence:CCGGCTACCTAAGATAGCGGTTGATCTCGAGATCAACCGCTATCTTAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000397.2-813s1c1
Sequence:CCGGCCTATGACTTGGAAATGGATACTCGAGTATCCATTTCCAAGTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000397.2-93s1c1
Sequence:CCGGGTCTGGTATTACCGGGTTTATCTCGAGATAAACCCGGTAATACCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000397.3-605s21c1
Sequence:CCGGATCACGCTGTGCCTCATATTACTCGAGTAATATGAGGCACAGCGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000397.3-2212s21c1
Sequence:CCGGGAAACCAAGGAGTAGCTATATCTCGAGATATAGCTACTCCTTGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000397.3-723s21c1
Sequence:CCGGTCCATGGAGCTGAACGAATTGCTCGAGCAATTCGTTCAGCTCCATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000397
CYBB MISSION shRNA Lentiviral Transduction Particles
cytochrome b-245, beta polypeptide
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000397.2-399s1c1
Sequence:CCGGGCCCGAGTCAATAATTCTGATCTCGAGATCAGAATTATTGACTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000397.2-1637s1c1
Sequence:CCGGCTTGGCTGAAACCCTGAGTAACTCGAGTTACTCAGGGTTTCAGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000397.2-1158s1c1
Sequence:CCGGCTACCTAAGATAGCGGTTGATCTCGAGATCAACCGCTATCTTAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000397.2-813s1c1
Sequence:CCGGCCTATGACTTGGAAATGGATACTCGAGTATCCATTTCCAAGTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000397.2-93s1c1
Sequence:CCGGGTCTGGTATTACCGGGTTTATCTCGAGATAAACCCGGTAATACCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000397.3-605s21c1
Sequence:CCGGATCACGCTGTGCCTCATATTACTCGAGTAATATGAGGCACAGCGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000397.3-2212s21c1
Sequence:CCGGGAAACCAAGGAGTAGCTATATCTCGAGATATAGCTACTCCTTGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000397.3-723s21c1
Sequence:CCGGTCCATGGAGCTGAACGAATTGCTCGAGCAATTCGTTCAGCTCCATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007807
CYBB MISSION shRNA Bacterial Glycerol Stock
cytochrome b-245, beta polypeptide
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007807.2-191s1c1
Sequence:CCGGCCTGCCTGAATTTCAACTGTACTCGAGTACAGTTGAAATTCAGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007807.2-1016s1c1
Sequence:CCGGCCAAGTTAGAATGGCACACATCTCGAGATGTGTGCCATTCTAACTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007807.2-1153s1c1
Sequence:CCGGGCCTGGAAACTACCTAAGATACTCGAGTATCTTAGGTAGTTTCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007807.2-716s1c1
Sequence:CCGGCGGAGAGTTTGGAAGAGCATACTCGAGTATGCTCTTCCAAACTCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007807.4-518s21c1
Sequence:CCGGGAACGAAGAGTATCTCAATTTCTCGAGAAATTGAGATACTCTTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007807.4-172s21c1
Sequence:CCGGATGATGATGGGCCTAAGTATACTCGAGTATACTTAGGCCCATCATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007807.4-736s21c1
Sequence:CCGGTCCATGGAGCTGAACGAATTGCTCGAGCAATTCGTTCAGCTCCATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007807
CYBB MISSION shRNA shRNA Plasmid DNA
cytochrome b-245, beta polypeptide
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007807.2-191s1c1
Sequence:CCGGCCTGCCTGAATTTCAACTGTACTCGAGTACAGTTGAAATTCAGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007807.2-1016s1c1
Sequence:CCGGCCAAGTTAGAATGGCACACATCTCGAGATGTGTGCCATTCTAACTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007807.2-1153s1c1
Sequence:CCGGGCCTGGAAACTACCTAAGATACTCGAGTATCTTAGGTAGTTTCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007807.2-716s1c1
Sequence:CCGGCGGAGAGTTTGGAAGAGCATACTCGAGTATGCTCTTCCAAACTCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007807.4-518s21c1
Sequence:CCGGGAACGAAGAGTATCTCAATTTCTCGAGAAATTGAGATACTCTTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007807.4-172s21c1
Sequence:CCGGATGATGATGGGCCTAAGTATACTCGAGTATACTTAGGCCCATCATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007807.4-736s21c1
Sequence:CCGGTCCATGGAGCTGAACGAATTGCTCGAGCAATTCGTTCAGCTCCATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007807
CYBB MISSION shRNA Lentiviral Transduction Particles
cytochrome b-245, beta polypeptide
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007807.2-191s1c1
Sequence:CCGGCCTGCCTGAATTTCAACTGTACTCGAGTACAGTTGAAATTCAGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007807.2-1016s1c1
Sequence:CCGGCCAAGTTAGAATGGCACACATCTCGAGATGTGTGCCATTCTAACTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007807.2-1153s1c1
Sequence:CCGGGCCTGGAAACTACCTAAGATACTCGAGTATCTTAGGTAGTTTCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007807.2-716s1c1
Sequence:CCGGCGGAGAGTTTGGAAGAGCATACTCGAGTATGCTCTTCCAAACTCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007807.4-518s21c1
Sequence:CCGGGAACGAAGAGTATCTCAATTTCTCGAGAAATTGAGATACTCTTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007807.4-172s21c1
Sequence:CCGGATGATGATGGGCCTAAGTATACTCGAGTATACTTAGGCCCATCATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007807.4-736s21c1
Sequence:CCGGTCCATGGAGCTGAACGAATTGCTCGAGCAATTCGTTCAGCTCCATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks