EMAIL THIS PAGE TO A FRIEND

CYBRD1

cytochrome b reductase 1

214 Gene Product Result for
Synonyms: CYB561A2 DCYTB FRRS3
Gene ID:
Human(79901) Summary: This gene is a member of the cytochrome b(561) family that encodes an iron-regulated protein. It highly expressed in the duodenal brush border membrane. It has ferric reductase activity and is believed to play a physiological role in dietary iron absorption. [provided by RefSeq, Jul 2008]
Mouse(73649) cytochrome b reductase 1
Rat(295669) cytochrome b reductase 1
Goat(100861136) cytochrome b reductase 1
Zebrafish(552960) cytochrome b reductase 1
cow(534257) cytochrome b reductase 1
dog(478796) cytochrome b reductase 1
chicken(424152) cytochrome b reductase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028593 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028593 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028593 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024843 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024843 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024843 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU156701 MISSION® esiRNA esiRNA targeting mouse Cybrd1 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127383 Rosetta Predictions human pricing
NM_024843 Rosetta Predictions human pricing
NM_001011954 Rosetta Predictions rat pricing
XM_575148 Rosetta Predictions rat pricing
NM_028593 Rosetta Predictions mouse pricing
XM_910566 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127383 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329314 predicted 990
2 SASI_Hs02_00329315 predicted 1109
3 SASI_Hs02_00329316 predicted 698
4 SASI_Hs02_00329317 predicted 667
5 SASI_Hs02_00329318 predicted 904
6 SASI_Hs02_00329319 predicted 1128
7 SASI_Hs02_00329320 predicted 668
8 SASI_Hs02_00329321 predicted 950
9 SASI_Hs02_00329322 predicted 1037
10 SASI_Hs02_00329323 predicted 898
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024843 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357411 predicted 1202
2 SASI_Hs02_00357412 predicted 1314
3 SASI_Hs02_00357413 predicted 905
4 SASI_Hs01_00127226 predicted 870
5 SASI_Hs01_00127228 predicted 1109
6 SASI_Hs02_00357414 predicted 1344
7 SASI_Hs01_00127232 predicted 872
8 SASI_Hs02_00357415 predicted 1164
9 SASI_Hs02_00357416 predicted 1247
10 SASI_Hs01_00127233 predicted 1112
11 SASI_Hs01_00127225 predicted 599
12 SASI_Hs01_00127227 predicted 603
13 SASI_Hs01_00127229 predicted 529
14 SASI_Hs01_00127230 predicted 441
15 SASI_Hs01_00127231 predicted 632
16 SASI_Hs01_00127234 predicted 593
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011954 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114349 predicted 749
2 SASI_Rn01_00114350 predicted 696
3 SASI_Rn01_00114352 predicted 1160
4 SASI_Rn01_00114353 predicted 890
5 SASI_Rn01_00114354 predicted 1088
6 SASI_Rn01_00114356 predicted 855
7 SASI_Rn01_00114357 predicted 1024
8 SASI_Rn02_00199969 predicted 993
9 SASI_Rn01_00114358 predicted 1021
10 SASI_Rn02_00199970 predicted 696
11 SASI_Rn01_00114351 predicted 318
12 SASI_Rn01_00114355 predicted 885
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575148 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00196560 predicted 812
2 SASI_Rn01_00196561 predicted 748
3 SASI_Rn01_00196562 predicted 369
4 SASI_Rn01_00196563 predicted 1217
5 SASI_Rn01_00196564 predicted 952
6 SASI_Rn01_00196565 predicted 1154
7 SASI_Rn01_00196566 predicted 933
8 SASI_Rn01_00196567 predicted 912
9 SASI_Rn01_00196568 predicted 1080
10 SASI_Rn01_00196569 predicted 1073
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028593 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334060 predicted 431
2 SASI_Mm02_00334061 predicted 1050
3 SASI_Mm02_00334062 predicted 950
4 SASI_Mm02_00334063 predicted 314
5 SASI_Mm02_00334064 predicted 534
6 SASI_Mm02_00334065 predicted 454
7 SASI_Mm02_00334066 predicted 995
8 SASI_Mm02_00334067 predicted 686
9 SASI_Mm02_00334068 predicted 337
10 SASI_Mm02_00334069 predicted 623
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_910566 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00210648 predicted 731
2 SASI_Mm01_00210649 predicted 1360
3 SASI_Mm01_00210650 predicted 1260
4 SASI_Mm01_00210651 predicted 616
5 SASI_Mm01_00210652 predicted 837
6 SASI_Mm01_00210653 predicted 761
7 SASI_Mm01_00210654 predicted 1309
8 SASI_Mm01_00210655 predicted 1001
9 SASI_Mm01_00210656 predicted 931
10 SASI_Mm01_00210657 predicted 834
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028593
CYBRD1 MISSION shRNA Bacterial Glycerol Stock
cytochrome b reductase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028593.2-434s21c1
Sequence:CCGGTTGGACTGACAGCTCTCATACCTCGAGGTATGAGAGCTGTCAGTCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028593.2-803s21c1
Sequence:CCGGTGGAAGGCGCCATAGCAATAACTCGAGTTATTGCTATGGCGCCTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251201    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028593.2-4934s21c1
Sequence:CCGGGACGAGATGTTTAGCTATAAACTCGAGTTTATAGCTAAACATCTCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028593.2-530s21c1
Sequence:CCGGTCATGCCCATACACGTGTATTCTCGAGAATACACGTGTATGGGCATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028593.2-315s21c1
Sequence:CCGGATCCATCCATGCCGGGTTAAACTCGAGTTTAACCCGGCATGGATGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028593
CYBRD1 MISSION shRNA shRNA Plasmid DNA
cytochrome b reductase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028593.2-434s21c1
Sequence:CCGGTTGGACTGACAGCTCTCATACCTCGAGGTATGAGAGCTGTCAGTCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028593.2-803s21c1
Sequence:CCGGTGGAAGGCGCCATAGCAATAACTCGAGTTATTGCTATGGCGCCTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251201    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028593.2-4934s21c1
Sequence:CCGGGACGAGATGTTTAGCTATAAACTCGAGTTTATAGCTAAACATCTCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028593.2-530s21c1
Sequence:CCGGTCATGCCCATACACGTGTATTCTCGAGAATACACGTGTATGGGCATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028593.2-315s21c1
Sequence:CCGGATCCATCCATGCCGGGTTAAACTCGAGTTTAACCCGGCATGGATGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028593
CYBRD1 MISSION shRNA Lentiviral Transduction Particles
cytochrome b reductase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028593.2-434s21c1
Sequence:CCGGTTGGACTGACAGCTCTCATACCTCGAGGTATGAGAGCTGTCAGTCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028593.2-803s21c1
Sequence:CCGGTGGAAGGCGCCATAGCAATAACTCGAGTTATTGCTATGGCGCCTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251201    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028593.2-4934s21c1
Sequence:CCGGGACGAGATGTTTAGCTATAAACTCGAGTTTATAGCTAAACATCTCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028593.2-530s21c1
Sequence:CCGGTCATGCCCATACACGTGTATTCTCGAGAATACACGTGTATGGGCATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028593.2-315s21c1
Sequence:CCGGATCCATCCATGCCGGGTTAAACTCGAGTTTAACCCGGCATGGATGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024843
VALIDATED
CYBRD1 MISSION shRNA Bacterial Glycerol Stock
cytochrome b reductase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024843.3-312s21c1
Sequence:CCGGATGGGAGCGCACTAGAGTTTACTCGAGTAAACTCTAGTGCGCTCCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024843.3-654s21c1
Sequence:CCGGTCATGCCCATACATGTTTATTCTCGAGAATAAACATGTATGGGCATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024843.3-865s21c1
Sequence:CCGGACGTCCTAAGGAGCCAAATTCCTCGAGGAATTTGGCTCCTTAGGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024843.3-440s21c1
Sequence:CCGGTCCATCCATGCAGGGTTAAATCTCGAGATTTAACCCTGCATGGATGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236453    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024843.3-1057s21c1
Sequence:CCGGTGTAGAGATAGAGCCATATAACTCGAGTTATATGGCTCTATCTCTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024843.2-380s1c1
Sequence:CCGGGCCGTGTTTGAGAACCACAATCTCGAGATTGTGGTTCTCAAACACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024843.2-440s1c1
Sequence:CCGGGTTGGACTGATAGCTGTCATACTCGAGTATGACAGCTATCAGTCCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024843.2-130s1c1
Sequence:CCGGCGGCTTCCTGTCGGTGATCTTCTCGAGAAGATCACCGACAGGAAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024843.2-527s1c1
Sequence:CCGGCGAGCATTTCTCATGCCCATACTCGAGTATGGGCATGAGAAATGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024843.2-830s1c1
Sequence:CCGGTCTGGCAACAACATGGACAAACTCGAGTTTGTCCATGTTGTTGCCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024843
VALIDATED
CYBRD1 MISSION shRNA shRNA Plasmid DNA
cytochrome b reductase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024843.3-312s21c1
Sequence:CCGGATGGGAGCGCACTAGAGTTTACTCGAGTAAACTCTAGTGCGCTCCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024843.3-654s21c1
Sequence:CCGGTCATGCCCATACATGTTTATTCTCGAGAATAAACATGTATGGGCATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024843.3-865s21c1
Sequence:CCGGACGTCCTAAGGAGCCAAATTCCTCGAGGAATTTGGCTCCTTAGGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024843.3-440s21c1
Sequence:CCGGTCCATCCATGCAGGGTTAAATCTCGAGATTTAACCCTGCATGGATGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236453    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024843.3-1057s21c1
Sequence:CCGGTGTAGAGATAGAGCCATATAACTCGAGTTATATGGCTCTATCTCTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024843.2-380s1c1
Sequence:CCGGGCCGTGTTTGAGAACCACAATCTCGAGATTGTGGTTCTCAAACACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024843.2-440s1c1
Sequence:CCGGGTTGGACTGATAGCTGTCATACTCGAGTATGACAGCTATCAGTCCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024843.2-130s1c1
Sequence:CCGGCGGCTTCCTGTCGGTGATCTTCTCGAGAAGATCACCGACAGGAAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024843.2-527s1c1
Sequence:CCGGCGAGCATTTCTCATGCCCATACTCGAGTATGGGCATGAGAAATGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024843.2-830s1c1
Sequence:CCGGTCTGGCAACAACATGGACAAACTCGAGTTTGTCCATGTTGTTGCCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024843
VALIDATED
CYBRD1 MISSION shRNA Lentiviral Transduction Particles
cytochrome b reductase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024843.3-312s21c1
Sequence:CCGGATGGGAGCGCACTAGAGTTTACTCGAGTAAACTCTAGTGCGCTCCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024843.3-654s21c1
Sequence:CCGGTCATGCCCATACATGTTTATTCTCGAGAATAAACATGTATGGGCATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024843.3-865s21c1
Sequence:CCGGACGTCCTAAGGAGCCAAATTCCTCGAGGAATTTGGCTCCTTAGGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024843.3-440s21c1
Sequence:CCGGTCCATCCATGCAGGGTTAAATCTCGAGATTTAACCCTGCATGGATGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236453    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024843.3-1057s21c1
Sequence:CCGGTGTAGAGATAGAGCCATATAACTCGAGTTATATGGCTCTATCTCTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024843.2-380s1c1
Sequence:CCGGGCCGTGTTTGAGAACCACAATCTCGAGATTGTGGTTCTCAAACACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024843.2-440s1c1
Sequence:CCGGGTTGGACTGATAGCTGTCATACTCGAGTATGACAGCTATCAGTCCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024843.2-130s1c1
Sequence:CCGGCGGCTTCCTGTCGGTGATCTTCTCGAGAAGATCACCGACAGGAAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024843.2-527s1c1
Sequence:CCGGCGAGCATTTCTCATGCCCATACTCGAGTATGGGCATGAGAAATGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024843.2-830s1c1
Sequence:CCGGTCTGGCAACAACATGGACAAACTCGAGTTTGTCCATGTTGTTGCCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)