EMAIL THIS PAGE TO A FRIEND

CYC1

cytochrome c-1

55 Gene Product Result for
Synonyms: UQCR4
UniProtKB ID: P08574, Q5U062, Q6FHS7
Gene ID:
Mouse(66445) cytochrome c-1
Rat(300047) cytochrome c-1
Zebrafish(564379) cytochrome c-1
cow(512500) cytochrome c-1
dog(475121) cytochrome c-1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001916 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001916 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001916 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025567 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025567 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025567 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001916 Rosetta Predictions human pricing
NM_001130491 Rosetta Predictions rat pricing
NM_025567 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001916 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055532 predicted 543
2 SASI_Hs01_00055533 predicted 714
3 SASI_Hs01_00055537 predicted 819
4 SASI_Hs01_00055538 predicted 837
5 SASI_Hs02_00332798 predicted 320
6 SASI_Hs01_00055539 predicted 552
7 SASI_Hs01_00055540 predicted 583
8 SASI_Hs01_00055541 predicted 785
9 SASI_Hs02_00332799 predicted 544
10 SASI_Hs02_00332800 predicted 340
11 SASI_Hs01_00055534 predicted 847
12 SASI_Hs01_00055535 predicted 743
13 SASI_Hs01_00055536 predicted 929
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130491 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255349 predicted 690
2 SASI_Rn02_00255350 predicted 732
3 SASI_Rn02_00255351 predicted 583
4 SASI_Rn02_00255352 predicted 397
5 SASI_Rn02_00255353 predicted 820
6 SASI_Rn02_00255354 predicted 796
7 SASI_Rn02_00255355 predicted 673
8 SASI_Rn02_00255356 predicted 402
9 SASI_Rn02_00255357 predicted 804
10 SASI_Rn02_00255358 predicted 456
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025567 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00030100 predicted 835
2 SASI_Mm01_00030101 predicted 827
3 SASI_Mm01_00030102 predicted 900
4 SASI_Mm01_00030104 predicted 478
5 SASI_Mm02_00328542 predicted 904
6 SASI_Mm01_00030105 predicted 725
7 SASI_Mm02_00328543 predicted 648
8 SASI_Mm01_00030107 predicted 945
9 SASI_Mm01_00030108 predicted 258
10 SASI_Mm02_00328544 predicted 269
11 SASI_Mm01_00030103 predicted 548
12 SASI_Mm01_00030106 predicted 960
13 SASI_Mm01_00030109 predicted 819
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001916
VALIDATED
CYC1 MISSION shRNA Bacterial Glycerol Stock
cytochrome c-1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001916.2-743s1c1
Sequence:CCGGCCCATCTACACAGATGTCTTACTCGAGTAAGACATCTGTGTAGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_001916.2-514s1c1
Sequence:CCGGGCTGTTCGACTATTTCCCAAACTCGAGTTTGGGAAATAGTCGAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001916.2-506s1c1
Sequence:CCGGCCAGGGAAGCTGTTCGACTATCTCGAGATAGTCGAACAGCTTCCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_001916.2-233s1c1
Sequence:CCGGGCTCTGCATTCGGCTGTGAGTCTCGAGACTCACAGCCGAATGCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001916.2-928s1c1
Sequence:CCGGGCACAAGTGGTCAGTCCTGAACTCGAGTTCAGGACTGACCACTTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001916
VALIDATED
CYC1 MISSION shRNA shRNA Plasmid DNA
cytochrome c-1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001916.2-743s1c1
Sequence:CCGGCCCATCTACACAGATGTCTTACTCGAGTAAGACATCTGTGTAGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_001916.2-514s1c1
Sequence:CCGGGCTGTTCGACTATTTCCCAAACTCGAGTTTGGGAAATAGTCGAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001916.2-506s1c1
Sequence:CCGGCCAGGGAAGCTGTTCGACTATCTCGAGATAGTCGAACAGCTTCCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_001916.2-233s1c1
Sequence:CCGGGCTCTGCATTCGGCTGTGAGTCTCGAGACTCACAGCCGAATGCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001916.2-928s1c1
Sequence:CCGGGCACAAGTGGTCAGTCCTGAACTCGAGTTCAGGACTGACCACTTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001916
VALIDATED
CYC1 MISSION shRNA Lentiviral Transduction Particles
cytochrome c-1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001916.2-743s1c1
Sequence:CCGGCCCATCTACACAGATGTCTTACTCGAGTAAGACATCTGTGTAGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_001916.2-514s1c1
Sequence:CCGGGCTGTTCGACTATTTCCCAAACTCGAGTTTGGGAAATAGTCGAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001916.2-506s1c1
Sequence:CCGGCCAGGGAAGCTGTTCGACTATCTCGAGATAGTCGAACAGCTTCCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_001916.2-233s1c1
Sequence:CCGGGCTCTGCATTCGGCTGTGAGTCTCGAGACTCACAGCCGAATGCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001916.2-928s1c1
Sequence:CCGGGCACAAGTGGTCAGTCCTGAACTCGAGTTCAGGACTGACCACTTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025567
VALIDATED
CYC1 MISSION shRNA Bacterial Glycerol Stock
cytochrome c-1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025567.1-544s1c1
Sequence:CCGGCCAGGGAAGTTGTCTGACTATCTCGAGATAGTCAGACAACTTCCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100320    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025567.1-1037s1c1
Sequence:CCGGCTTGTCATCTTGCCAGAACAACTCGAGTTGTTCTGGCAAGATGACAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025567.1-601s1c1
Sequence:CCGGGCTGCTAACAATGGAGCTTTACTCGAGTAAAGCTCCATTGTTAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025567.1-951s1c1
Sequence:CCGGCTATGCCATGAAGCGGCATAACTCGAGTTATGCCGCTTCATGGCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025567.1-732s1c1
Sequence:CCGGCCTCTATTTCAACCCTTACTTCTCGAGAAGTAAGGGTTGAAATAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025567.2-543s21c1
Sequence:CCGGCCAGGGAAGTTGTCTGACTATCTCGAGATAGTCAGACAACTTCCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025567.2-600s21c1
Sequence:CCGGGCTGCTAACAATGGAGCTTTACTCGAGTAAAGCTCCATTGTTAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025567.2-731s21c1
Sequence:CCGGCCTCTATTTCAACCCTTACTTCTCGAGAAGTAAGGGTTGAAATAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351746    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025567.2-1036s21c1
Sequence:CCGGCTTGTCATCTTGCCAGAACAACTCGAGTTGTTCTGGCAAGATGACAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025567
VALIDATED
CYC1 MISSION shRNA shRNA Plasmid DNA
cytochrome c-1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025567.1-544s1c1
Sequence:CCGGCCAGGGAAGTTGTCTGACTATCTCGAGATAGTCAGACAACTTCCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100320    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025567.1-1037s1c1
Sequence:CCGGCTTGTCATCTTGCCAGAACAACTCGAGTTGTTCTGGCAAGATGACAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025567.1-601s1c1
Sequence:CCGGGCTGCTAACAATGGAGCTTTACTCGAGTAAAGCTCCATTGTTAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025567.1-951s1c1
Sequence:CCGGCTATGCCATGAAGCGGCATAACTCGAGTTATGCCGCTTCATGGCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025567.1-732s1c1
Sequence:CCGGCCTCTATTTCAACCCTTACTTCTCGAGAAGTAAGGGTTGAAATAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025567.2-543s21c1
Sequence:CCGGCCAGGGAAGTTGTCTGACTATCTCGAGATAGTCAGACAACTTCCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025567.2-600s21c1
Sequence:CCGGGCTGCTAACAATGGAGCTTTACTCGAGTAAAGCTCCATTGTTAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025567.2-731s21c1
Sequence:CCGGCCTCTATTTCAACCCTTACTTCTCGAGAAGTAAGGGTTGAAATAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351746    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025567.2-1036s21c1
Sequence:CCGGCTTGTCATCTTGCCAGAACAACTCGAGTTGTTCTGGCAAGATGACAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025567
VALIDATED
CYC1 MISSION shRNA Lentiviral Transduction Particles
cytochrome c-1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025567.1-544s1c1
Sequence:CCGGCCAGGGAAGTTGTCTGACTATCTCGAGATAGTCAGACAACTTCCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100320    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025567.1-1037s1c1
Sequence:CCGGCTTGTCATCTTGCCAGAACAACTCGAGTTGTTCTGGCAAGATGACAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025567.1-601s1c1
Sequence:CCGGGCTGCTAACAATGGAGCTTTACTCGAGTAAAGCTCCATTGTTAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025567.1-951s1c1
Sequence:CCGGCTATGCCATGAAGCGGCATAACTCGAGTTATGCCGCTTCATGGCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025567.1-732s1c1
Sequence:CCGGCCTCTATTTCAACCCTTACTTCTCGAGAAGTAAGGGTTGAAATAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025567.2-543s21c1
Sequence:CCGGCCAGGGAAGTTGTCTGACTATCTCGAGATAGTCAGACAACTTCCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025567.2-600s21c1
Sequence:CCGGGCTGCTAACAATGGAGCTTTACTCGAGTAAAGCTCCATTGTTAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025567.2-731s21c1
Sequence:CCGGCCTCTATTTCAACCCTTACTTCTCGAGAAGTAAGGGTTGAAATAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351746    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025567.2-1036s21c1
Sequence:CCGGCTTGTCATCTTGCCAGAACAACTCGAGTTGTTCTGGCAAGATGACAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)