EMAIL THIS PAGE TO A FRIEND

CYFIP1

cytoplasmic FMR1 interacting protein 1

80 Gene Product Result for
Synonyms: P140SRA-1 SHYC SRA1
Gene ID:
Mouse(20430) cytoplasmic FMR1 interacting protein 1
Rat(308666) cytoplasmic FMR1 interacting protein 1
Zebrafish(336613) cytoplasmic FMR1 interacting protein 1
domestic cat(101089755) cytoplasmic FMR1 interacting protein 1
cow(100141021) cytoplasmic FMR1 interacting protein 1
dog(479001) cytoplasmic FMR1 interacting protein 1
chicken(418677) cytoplasmic FMR1 interacting protein 1
domestic guinea pig(100729847) cytoplasmic FMR1 interacting protein 1
naked mole-rat(101715820) cytoplasmic FMR1 interacting protein 1
Goat(100861373) cytoplasmic FMR1 interacting protein 1
sheep(100188913) cytoplasmic FMR1 interacting protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014608 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014608 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014608 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011370 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011370 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011370 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033028 Rosetta Predictions human pricing
NM_014608 Rosetta Predictions human pricing
NM_001107517 Rosetta Predictions rat pricing
NM_011370 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033028 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038229 predicted 1071
2 SASI_Hs01_00038230 predicted 1365
3 SASI_Hs01_00038231 predicted 2568
4 SASI_Hs01_00038232 predicted 2557
5 SASI_Hs01_00038233 predicted 1100
6 SASI_Hs01_00038234 predicted 1327
7 SASI_Hs01_00038235 predicted 1596
8 SASI_Hs01_00038236 predicted 1914
9 SASI_Hs01_00038237 predicted 1567
10 SASI_Hs01_00038238 predicted 1135
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014608 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031209 predicted 2166
2 SASI_Hs01_00031210 predicted 2466
3 SASI_Hs01_00031211 predicted 3660
4 SASI_Hs01_00031212 predicted 3658
5 SASI_Hs01_00031213 predicted 2199
6 SASI_Hs01_00031214 predicted 2422
7 SASI_Hs01_00031215 predicted 2684
8 SASI_Hs01_00031216 predicted 3005
9 SASI_Hs01_00031217 predicted 2667
10 SASI_Hs01_00031218 predicted 2231
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107517 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229605 predicted 2525
2 SASI_Rn02_00229606 predicted 2241
3 SASI_Rn02_00229607 predicted 3244
4 SASI_Rn02_00229608 predicted 1306
5 SASI_Rn02_00229609 predicted 319
6 SASI_Rn02_00229610 predicted 2474
7 SASI_Rn02_00229611 predicted 473
8 SASI_Rn02_00229612 predicted 739
9 SASI_Rn02_00229613 predicted 630
10 SASI_Rn02_00229614 predicted 273
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011370 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112504 predicted 2518
2 SASI_Mm01_00112506 predicted 2385
3 SASI_Mm01_00112507 predicted 2803
4 SASI_Mm01_00112508 predicted 2466
5 SASI_Mm01_00112509 predicted 775
6 SASI_Mm02_00320541 predicted 343
7 SASI_Mm01_00112510 predicted 1665
8 SASI_Mm01_00112511 predicted 3893
9 SASI_Mm02_00320542 predicted 394
10 SASI_Mm02_00320543 predicted 725
11 SASI_Mm01_00112505 predicted 3567
12 SASI_Mm01_00112512 predicted 3244
13 SASI_Mm01_00112513 predicted 1016
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014608
VALIDATED
CYFIP1 MISSION shRNA Bacterial Glycerol Stock
cytoplasmic FMR1 interacting protein 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014608.1-1269s1c1
Sequence:CCGGCGCACGTGATGGAAGTGTATTCTCGAGAATACACTTCCATCACGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163972    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014608.1-3258s1c1
Sequence:CCGGCTCAGCAAATTGCCATCGCAACTCGAGTTGCGATGGCAATTTGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014608.1-2171s1c1
Sequence:CCGGGCAGACCAGATATTTGCCTATCTCGAGATAGGCAAATATCTGGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014608.1-3685s1c1
Sequence:CCGGCCAGATTCTCAATGATGAGATCTCGAGATCTCATCATTGAGAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000188878    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014608.1-352s1c1
Sequence:CCGGGCAGCCTAACAGAGTGGAAATCTCGAGATTTCCACTCTGTTAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186347    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014608.1-3595s1c1
Sequence:CCGGCCATCTACTTAAAGTCCAGAACTCGAGTTCTGGACTTTAAGTAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014608
VALIDATED
CYFIP1 MISSION shRNA shRNA Plasmid DNA
cytoplasmic FMR1 interacting protein 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014608.1-1269s1c1
Sequence:CCGGCGCACGTGATGGAAGTGTATTCTCGAGAATACACTTCCATCACGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163972    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014608.1-3258s1c1
Sequence:CCGGCTCAGCAAATTGCCATCGCAACTCGAGTTGCGATGGCAATTTGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014608.1-2171s1c1
Sequence:CCGGGCAGACCAGATATTTGCCTATCTCGAGATAGGCAAATATCTGGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014608.1-3685s1c1
Sequence:CCGGCCAGATTCTCAATGATGAGATCTCGAGATCTCATCATTGAGAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000188878    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014608.1-352s1c1
Sequence:CCGGGCAGCCTAACAGAGTGGAAATCTCGAGATTTCCACTCTGTTAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186347    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014608.1-3595s1c1
Sequence:CCGGCCATCTACTTAAAGTCCAGAACTCGAGTTCTGGACTTTAAGTAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014608
VALIDATED
CYFIP1 MISSION shRNA Lentiviral Transduction Particles
cytoplasmic FMR1 interacting protein 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014608.1-1269s1c1
Sequence:CCGGCGCACGTGATGGAAGTGTATTCTCGAGAATACACTTCCATCACGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163972    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014608.1-3258s1c1
Sequence:CCGGCTCAGCAAATTGCCATCGCAACTCGAGTTGCGATGGCAATTTGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014608.1-2171s1c1
Sequence:CCGGGCAGACCAGATATTTGCCTATCTCGAGATAGGCAAATATCTGGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014608.1-3685s1c1
Sequence:CCGGCCAGATTCTCAATGATGAGATCTCGAGATCTCATCATTGAGAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000188878    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014608.1-352s1c1
Sequence:CCGGGCAGCCTAACAGAGTGGAAATCTCGAGATTTCCACTCTGTTAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186347    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014608.1-3595s1c1
Sequence:CCGGCCATCTACTTAAAGTCCAGAACTCGAGTTCTGGACTTTAAGTAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011370
VALIDATED
CYFIP1 MISSION shRNA Bacterial Glycerol Stock
cytoplasmic FMR1 interacting protein 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098315    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011370.1-3815s1c1
Sequence:CCGGCCAGTAACTGATGGCATGTTTCTCGAGAAACATGCCATCAGTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011370.1-137s1c1
Sequence:CCGGCGCTGCTCTATCAGCCAAATTCTCGAGAATTTGGCTGATAGAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011370.1-3666s1c1
Sequence:CCGGCCAGATTCTCAACGATGAAATCTCGAGATTTCATCGTTGAGAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011370.1-3117s1c1
Sequence:CCGGCCAGAATATCTTACCTCGAATCTCGAGATTCGAGGTAAGATATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011370.1-1792s1c1
Sequence:CCGGCCCACCATATTGGACATAGAACTCGAGTTCTATGTCCAATATGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011370.2-3870s21c1
Sequence:CCGGCCAGATTCTCAACGATGAAATCTCGAGATTTCATCGTTGAGAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324539    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011370.2-4019s21c1
Sequence:CCGGCCAGTAACTGATGGCATGTTTCTCGAGAAACATGCCATCAGTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011370.2-341s21c1
Sequence:CCGGCGCTGCTCTATCAGCCAAATTCTCGAGAATTTGGCTGATAGAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011370.2-3321s21c1
Sequence:CCGGCCAGAATATCTTACCTCGAATCTCGAGATTCGAGGTAAGATATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011370
VALIDATED
CYFIP1 MISSION shRNA shRNA Plasmid DNA
cytoplasmic FMR1 interacting protein 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098315    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011370.1-3815s1c1
Sequence:CCGGCCAGTAACTGATGGCATGTTTCTCGAGAAACATGCCATCAGTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011370.1-137s1c1
Sequence:CCGGCGCTGCTCTATCAGCCAAATTCTCGAGAATTTGGCTGATAGAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011370.1-3666s1c1
Sequence:CCGGCCAGATTCTCAACGATGAAATCTCGAGATTTCATCGTTGAGAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011370.1-3117s1c1
Sequence:CCGGCCAGAATATCTTACCTCGAATCTCGAGATTCGAGGTAAGATATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011370.1-1792s1c1
Sequence:CCGGCCCACCATATTGGACATAGAACTCGAGTTCTATGTCCAATATGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011370.2-3870s21c1
Sequence:CCGGCCAGATTCTCAACGATGAAATCTCGAGATTTCATCGTTGAGAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324539    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011370.2-4019s21c1
Sequence:CCGGCCAGTAACTGATGGCATGTTTCTCGAGAAACATGCCATCAGTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011370.2-341s21c1
Sequence:CCGGCGCTGCTCTATCAGCCAAATTCTCGAGAATTTGGCTGATAGAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011370.2-3321s21c1
Sequence:CCGGCCAGAATATCTTACCTCGAATCTCGAGATTCGAGGTAAGATATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011370
VALIDATED
CYFIP1 MISSION shRNA Lentiviral Transduction Particles
cytoplasmic FMR1 interacting protein 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098315    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011370.1-3815s1c1
Sequence:CCGGCCAGTAACTGATGGCATGTTTCTCGAGAAACATGCCATCAGTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011370.1-137s1c1
Sequence:CCGGCGCTGCTCTATCAGCCAAATTCTCGAGAATTTGGCTGATAGAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011370.1-3666s1c1
Sequence:CCGGCCAGATTCTCAACGATGAAATCTCGAGATTTCATCGTTGAGAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011370.1-3117s1c1
Sequence:CCGGCCAGAATATCTTACCTCGAATCTCGAGATTCGAGGTAAGATATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011370.1-1792s1c1
Sequence:CCGGCCCACCATATTGGACATAGAACTCGAGTTCTATGTCCAATATGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011370.2-3870s21c1
Sequence:CCGGCCAGATTCTCAACGATGAAATCTCGAGATTTCATCGTTGAGAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324539    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011370.2-4019s21c1
Sequence:CCGGCCAGTAACTGATGGCATGTTTCTCGAGAAACATGCCATCAGTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011370.2-341s21c1
Sequence:CCGGCGCTGCTCTATCAGCCAAATTCTCGAGAATTTGGCTGATAGAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011370.2-3321s21c1
Sequence:CCGGCCAGAATATCTTACCTCGAATCTCGAGATTCGAGGTAAGATATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks