EMAIL THIS PAGE TO A FRIEND

CYFIP2

cytoplasmic FMR1 interacting protein 2

105 Gene Product Result for
Synonyms: PIR121
Gene ID:
Mouse(76884) cytoplasmic FMR1 interacting protein 2
Rat(303073) cytoplasmic FMR1 interacting protein 2
sheep(101113147) cytoplasmic FMR1 interacting protein 2
naked mole-rat(101708581) cytoplasmic FMR1 interacting protein 2
domestic guinea pig(100724311) cytoplasmic FMR1 interacting protein 2
Zebrafish(100002872) cytoplasmic FMR1 interacting protein 2
cow(518833) cytoplasmic FMR1 interacting protein 2
Horse(100071224) cytoplasmic FMR1 interacting protein 2
domestic cat(101101031) cytoplasmic FMR1 interacting protein 2
dog(479317) cytoplasmic FMR1 interacting protein 2
chicken(416246) cytoplasmic FMR1 interacting protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133769 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133769 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133769 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014376 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014376 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014376 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037332 Rosetta Predictions human pricing
NM_001037333 Rosetta Predictions human pricing
NM_014376 Rosetta Predictions human pricing
NM_001106996 Rosetta Predictions rat pricing
NM_133769 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037332 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100372 predicted 2932
2 SASI_Hs01_00100373 predicted 1278
3 SASI_Hs01_00100374 predicted 2985
4 SASI_Hs01_00100375 predicted 3070
5 SASI_Hs01_00100376 predicted 986
6 SASI_Hs01_00100377 predicted 3121
7 SASI_Hs01_00100378 predicted 3186
8 SASI_Hs02_00308280 predicted 1739
9 SASI_Hs01_00100379 predicted 2185
10 SASI_Hs02_00308281 predicted 2297
11 SASI_Hs01_00100371 predicted 2200
12 SASI_Hs01_00100380 predicted 1408
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037333 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023042 predicted 2639
2 SASI_Hs01_00023043 predicted 986
3 SASI_Hs01_00023044 predicted 2699
4 SASI_Hs01_00023045 predicted 2780
5 SASI_Hs01_00023046 predicted 697
6 SASI_Hs01_00023047 predicted 2830
7 SASI_Hs01_00023048 predicted 2889
8 SASI_Hs02_00308282 predicted 1449
9 SASI_Hs01_00023049 predicted 1892
10 SASI_Hs02_00308283 predicted 2006
11 SASI_Hs01_00023041 predicted 1910
12 SASI_Hs01_00023050 predicted 1118
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014376 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025758 predicted 2764
2 SASI_Hs01_00025759 predicted 1104
3 SASI_Hs01_00025760 predicted 2813
4 SASI_Hs01_00025761 predicted 2894
5 SASI_Hs01_00025762 predicted 805
6 SASI_Hs01_00025763 predicted 2940
7 SASI_Hs01_00025764 predicted 3012
8 SASI_Hs02_00345534 predicted 1565
9 SASI_Hs01_00025765 predicted 2003
10 SASI_Hs02_00345535 predicted 2118
11 SASI_Hs01_00025757 predicted 2022
12 SASI_Hs01_00025766 predicted 1231
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106996 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224456 predicted 2342
2 SASI_Rn02_00224457 predicted 2847
3 SASI_Rn02_00224458 predicted 2941
4 SASI_Rn02_00224459 predicted 2220
5 SASI_Rn02_00224460 predicted 3081
6 SASI_Rn02_00224461 predicted 2619
7 SASI_Rn02_00224462 predicted 2820
8 SASI_Rn02_00224463 predicted 2612
9 SASI_Rn02_00224464 predicted 2658
10 SASI_Rn02_00224465 predicted 3516
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133769 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061566 predicted 2772
2 SASI_Mm02_00338776 predicted 3096
3 SASI_Mm01_00061569 predicted 764
4 SASI_Mm01_00061570 predicted 2787
5 SASI_Mm02_00338777 predicted 967
6 SASI_Mm02_00338778 predicted 2709
7 SASI_Mm01_00061571 predicted 1359
8 SASI_Mm01_00061572 predicted 2581
9 SASI_Mm01_00061573 predicted 2999
10 SASI_Mm01_00061574 predicted 2754
11 SASI_Mm01_00061567 predicted 2085
12 SASI_Mm01_00061568 predicted 1131
13 SASI_Mm01_00061575 predicted 2052
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133769
VALIDATED
CYFIP2 MISSION shRNA Bacterial Glycerol Stock
cytoplasmic FMR1 interacting protein 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133769.2-2985s21c1
Sequence:CCGGAGTACGTGAAGACGCTCATAGCTCGAGCTATGAGCGTCTTCACGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133769.2-2212s21c1
Sequence:CCGGCGAGATCGAAGCCGAGGTAAACTCGAGTTTACCTCGGCTTCGATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097700    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133769.1-3865s1c1
Sequence:CCGGGCAGACCTTCAACCTGGAGGACTCGAGTCCTCCAGGTTGAAGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133769.1-2021s1c1
Sequence:CCGGCCTGGATTCTAACGGACCATACTCGAGTATGGTCCGTTAGAATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133769.1-204s1c1
Sequence:CCGGCCAGGCTAACTTTGACACGAACTCGAGTTCGTGTCAAAGTTAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133769.1-3657s1c1
Sequence:CCGGCGGGAAGGATGAGATCATTAACTCGAGTTAATGATCTCATCCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133769.1-947s1c1
Sequence:CCGGCCAAGAAGAGAATCAACCTTACTCGAGTAAGGTTGATTCTCTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133769
VALIDATED
CYFIP2 MISSION shRNA shRNA Plasmid DNA
cytoplasmic FMR1 interacting protein 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133769.2-2985s21c1
Sequence:CCGGAGTACGTGAAGACGCTCATAGCTCGAGCTATGAGCGTCTTCACGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133769.2-2212s21c1
Sequence:CCGGCGAGATCGAAGCCGAGGTAAACTCGAGTTTACCTCGGCTTCGATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097700    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133769.1-3865s1c1
Sequence:CCGGGCAGACCTTCAACCTGGAGGACTCGAGTCCTCCAGGTTGAAGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133769.1-2021s1c1
Sequence:CCGGCCTGGATTCTAACGGACCATACTCGAGTATGGTCCGTTAGAATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133769.1-204s1c1
Sequence:CCGGCCAGGCTAACTTTGACACGAACTCGAGTTCGTGTCAAAGTTAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133769.1-3657s1c1
Sequence:CCGGCGGGAAGGATGAGATCATTAACTCGAGTTAATGATCTCATCCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133769.1-947s1c1
Sequence:CCGGCCAAGAAGAGAATCAACCTTACTCGAGTAAGGTTGATTCTCTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133769
VALIDATED
CYFIP2 MISSION shRNA Lentiviral Transduction Particles
cytoplasmic FMR1 interacting protein 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133769.2-2985s21c1
Sequence:CCGGAGTACGTGAAGACGCTCATAGCTCGAGCTATGAGCGTCTTCACGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133769.2-2212s21c1
Sequence:CCGGCGAGATCGAAGCCGAGGTAAACTCGAGTTTACCTCGGCTTCGATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097700    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133769.1-3865s1c1
Sequence:CCGGGCAGACCTTCAACCTGGAGGACTCGAGTCCTCCAGGTTGAAGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133769.1-2021s1c1
Sequence:CCGGCCTGGATTCTAACGGACCATACTCGAGTATGGTCCGTTAGAATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133769.1-204s1c1
Sequence:CCGGCCAGGCTAACTTTGACACGAACTCGAGTTCGTGTCAAAGTTAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133769.1-3657s1c1
Sequence:CCGGCGGGAAGGATGAGATCATTAACTCGAGTTAATGATCTCATCCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133769.1-947s1c1
Sequence:CCGGCCAAGAAGAGAATCAACCTTACTCGAGTAAGGTTGATTCTCTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014376
VALIDATED
CYFIP2 MISSION shRNA Bacterial Glycerol Stock
cytoplasmic FMR1 interacting protein 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242602    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014376.2-6379s21c1
Sequence:CCGGACTGTCAAATGTACCATATTTCTCGAGAAATATGGTACATTTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014376.2-2264s21c1
Sequence:CCGGACAACGACAGCGCCTACTATGCTCGAGCATAGTAGGCGCTGTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014376.2-2518s21c1
Sequence:CCGGCAGCTGTTGGGTAGATCAATTCTCGAGAATTGATCTACCCAACAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014376.2-759s21c1
Sequence:CCGGTGCTGTCCTGGATGAGCTAAACTCGAGTTTAGCTCATCCAGGACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014376.2-362s21c1
Sequence:CCGGTCATGTACCAGGCTAACTTTGCTCGAGCAAAGTTAGCCTGGTACATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181001    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014376.1-1074s1c1
Sequence:CCGGGCCTCTACCTAATGGATGGAACTCGAGTTCCATCCATTAGGTAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180785    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014376.1-976s1c1
Sequence:CCGGGCTGGCTGACATTGTCAACATCTCGAGATGTTGACAATGTCAGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014376
VALIDATED
CYFIP2 MISSION shRNA shRNA Plasmid DNA
cytoplasmic FMR1 interacting protein 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242602    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014376.2-6379s21c1
Sequence:CCGGACTGTCAAATGTACCATATTTCTCGAGAAATATGGTACATTTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014376.2-2264s21c1
Sequence:CCGGACAACGACAGCGCCTACTATGCTCGAGCATAGTAGGCGCTGTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014376.2-2518s21c1
Sequence:CCGGCAGCTGTTGGGTAGATCAATTCTCGAGAATTGATCTACCCAACAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014376.2-759s21c1
Sequence:CCGGTGCTGTCCTGGATGAGCTAAACTCGAGTTTAGCTCATCCAGGACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014376.2-362s21c1
Sequence:CCGGTCATGTACCAGGCTAACTTTGCTCGAGCAAAGTTAGCCTGGTACATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181001    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014376.1-1074s1c1
Sequence:CCGGGCCTCTACCTAATGGATGGAACTCGAGTTCCATCCATTAGGTAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180785    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014376.1-976s1c1
Sequence:CCGGGCTGGCTGACATTGTCAACATCTCGAGATGTTGACAATGTCAGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014376
VALIDATED
CYFIP2 MISSION shRNA Lentiviral Transduction Particles
cytoplasmic FMR1 interacting protein 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242602    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014376.2-6379s21c1
Sequence:CCGGACTGTCAAATGTACCATATTTCTCGAGAAATATGGTACATTTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014376.2-2264s21c1
Sequence:CCGGACAACGACAGCGCCTACTATGCTCGAGCATAGTAGGCGCTGTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014376.2-2518s21c1
Sequence:CCGGCAGCTGTTGGGTAGATCAATTCTCGAGAATTGATCTACCCAACAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014376.2-759s21c1
Sequence:CCGGTGCTGTCCTGGATGAGCTAAACTCGAGTTTAGCTCATCCAGGACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014376.2-362s21c1
Sequence:CCGGTCATGTACCAGGCTAACTTTGCTCGAGCAAAGTTAGCCTGGTACATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181001    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014376.1-1074s1c1
Sequence:CCGGGCCTCTACCTAATGGATGGAACTCGAGTTCCATCCATTAGGTAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180785    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014376.1-976s1c1
Sequence:CCGGGCTGGCTGACATTGTCAACATCTCGAGATGTTGACAATGTCAGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks