EMAIL THIS PAGE TO A FRIEND

CYGB

cytoglobin

98 Gene Product Result for
Synonyms: HGB STAP
UniProtKB ID: Q8WWM9, Q541Y7, Q8N2X5
Gene ID:
Human(114757) Summary: This gene encodes a globin protein found in vertebrate cells. The encoded protein is described as a hexacoordinate hemoglobin which binds ligand differently from the pentacoordinate hemoglobins involved in oxygen transport, and may be involved in protection during oxidative stress. This gene is located on chromosome 17 in the same region as a retinal gene which is mutated in progressive rod-cone degeneration, but in the opposite orientation. [provided by RefSeq, Jan 2012]
Mouse(114886) cytoglobin
Rat(170520) cytoglobin
chicken(427802) cytoglobin
cow(510299) cytoglobin
dog(609341) cytoglobin
sheep(100307038) cytoglobin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030206 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030206 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030206 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_134268 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_134268 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_134268 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_134268 Rosetta Predictions human pricing
NM_130744 Rosetta Predictions rat pricing
NM_030206 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134268 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102750 predicted 826
2 SASI_Hs01_00102754 predicted 762
3 SASI_Hs02_00363306 predicted 767
4 SASI_Hs02_00363307 predicted 794
5 SASI_Hs02_00363308 predicted 764
6 SASI_Hs01_00102757 predicted 507
7 SASI_Hs01_00102752 predicted 420
8 SASI_Hs01_00102753 predicted 493
9 SASI_Hs01_00102755 predicted 636
10 SASI_Hs01_00102756 predicted 607
11 SASI_Hs01_00102751 predicted 519
12 SASI_Hs01_00102758 predicted 1117
13 SASI_Hs01_00102759 predicted 252
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130744 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069693 predicted 918
2 SASI_Rn01_00069694 predicted 642
3 SASI_Rn01_00069696 predicted 337
4 SASI_Rn01_00069697 predicted 624
5 SASI_Rn02_00267475 predicted 803
6 SASI_Rn01_00069698 predicted 339
7 SASI_Rn01_00069699 predicted 801
8 SASI_Rn02_00267476 predicted 332
9 SASI_Rn01_00069700 predicted 618
10 SASI_Rn01_00069701 predicted 526
11 SASI_Rn01_00069695 predicted 777
12 SASI_Rn01_00069702 predicted 867
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030206 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00066844 predicted 1020
2 SASI_Mm01_00066845 predicted 750
3 SASI_Mm01_00066846 predicted 562
4 SASI_Mm01_00066847 predicted 565
5 SASI_Mm01_00066848 predicted 865
6 SASI_Mm01_00066849 predicted 792
7 SASI_Mm01_00066850 predicted 1015
8 SASI_Mm01_00066851 predicted 731
9 SASI_Mm01_00066852 predicted 1073
10 SASI_Mm01_00066853 predicted 562
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030206
CYGB MISSION shRNA Bacterial Glycerol Stock
cytoglobin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030206.1-579s1c1
Sequence:CCGGCAGTTTAGACACATGGAGGATCTCGAGATCCTCCATGTGTCTAAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030206.1-803s1c1
Sequence:CCGGCGAGGAATTTGCCAATGACTTCTCGAGAAGTCATTGGCAAATTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030206.1-748s1c1
Sequence:CCGGAGGTGGAACCTATGTACTTTACTCGAGTAAAGTACATAGGTTCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105485    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030206.1-1931s1c1
Sequence:CCGGCCAGTGTATGTGTCCGGTATACTCGAGTATACCGGACACATACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030206.1-682s1c1
Sequence:CCGGTGCATGACCCAGACAAGGTATCTCGAGATACCTTGTCTGGGTCATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030206
CYGB MISSION shRNA shRNA Plasmid DNA
cytoglobin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030206.1-579s1c1
Sequence:CCGGCAGTTTAGACACATGGAGGATCTCGAGATCCTCCATGTGTCTAAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030206.1-803s1c1
Sequence:CCGGCGAGGAATTTGCCAATGACTTCTCGAGAAGTCATTGGCAAATTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030206.1-748s1c1
Sequence:CCGGAGGTGGAACCTATGTACTTTACTCGAGTAAAGTACATAGGTTCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105485    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030206.1-1931s1c1
Sequence:CCGGCCAGTGTATGTGTCCGGTATACTCGAGTATACCGGACACATACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030206.1-682s1c1
Sequence:CCGGTGCATGACCCAGACAAGGTATCTCGAGATACCTTGTCTGGGTCATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030206
CYGB MISSION shRNA Lentiviral Transduction Particles
cytoglobin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030206.1-579s1c1
Sequence:CCGGCAGTTTAGACACATGGAGGATCTCGAGATCCTCCATGTGTCTAAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030206.1-803s1c1
Sequence:CCGGCGAGGAATTTGCCAATGACTTCTCGAGAAGTCATTGGCAAATTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030206.1-748s1c1
Sequence:CCGGAGGTGGAACCTATGTACTTTACTCGAGTAAAGTACATAGGTTCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105485    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030206.1-1931s1c1
Sequence:CCGGCCAGTGTATGTGTCCGGTATACTCGAGTATACCGGACACATACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030206.1-682s1c1
Sequence:CCGGTGCATGACCCAGACAAGGTATCTCGAGATACCTTGTCTGGGTCATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134268
CYGB MISSION shRNA Bacterial Glycerol Stock
cytoglobin
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134268.3-1114s1c1
Sequence:CCGGCGCACACATCTACCATATATACTCGAGTATATATGGTAGATGTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134268.3-293s1c1
Sequence:CCGGCCTGGTGAGGTTCTTTGTGAACTCGAGTTCACAAAGAACCTCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134268.3-498s1c1
Sequence:CCGGGCCCTCAAGCACAAGGTGGAACTCGAGTTCCACCTTGTGCTTGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134268.3-520s1c1
Sequence:CCGGCGGTGTACTTCAAGATCCTCTCTCGAGAGAGGATCTTGAAGTACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134268.3-329s1c1
Sequence:CCGGGCAGTACTTCAGCCAGTTCAACTCGAGTTGAACTGGCTGAAGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134268
CYGB MISSION shRNA shRNA Plasmid DNA
cytoglobin
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134268.3-1114s1c1
Sequence:CCGGCGCACACATCTACCATATATACTCGAGTATATATGGTAGATGTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134268.3-293s1c1
Sequence:CCGGCCTGGTGAGGTTCTTTGTGAACTCGAGTTCACAAAGAACCTCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134268.3-498s1c1
Sequence:CCGGGCCCTCAAGCACAAGGTGGAACTCGAGTTCCACCTTGTGCTTGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134268.3-520s1c1
Sequence:CCGGCGGTGTACTTCAAGATCCTCTCTCGAGAGAGGATCTTGAAGTACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134268.3-329s1c1
Sequence:CCGGGCAGTACTTCAGCCAGTTCAACTCGAGTTGAACTGGCTGAAGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134268
CYGB MISSION shRNA Lentiviral Transduction Particles
cytoglobin
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134268.3-1114s1c1
Sequence:CCGGCGCACACATCTACCATATATACTCGAGTATATATGGTAGATGTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134268.3-293s1c1
Sequence:CCGGCCTGGTGAGGTTCTTTGTGAACTCGAGTTCACAAAGAACCTCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134268.3-498s1c1
Sequence:CCGGGCCCTCAAGCACAAGGTGGAACTCGAGTTCCACCTTGTGCTTGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134268.3-520s1c1
Sequence:CCGGCGGTGTACTTCAAGATCCTCTCTCGAGAGAGGATCTTGAAGTACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134268.3-329s1c1
Sequence:CCGGGCAGTACTTCAGCCAGTTCAACTCGAGTTGAACTGGCTGAAGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks