EMAIL THIS PAGE TO A FRIEND

CYHR1

cysteine/histidine-rich 1

50 Gene Product Result for
Synonyms: CHRP
UniProtKB ID: Q6ZMK1, B3KSX0, D3DWM3, Q9BSF6, Q9BSU6
Gene ID:
Mouse(54151) cysteine and histidine rich 1
Rat(100362155) cysteine/histidine-rich 1
Zebrafish(767773) cysteine/histidine-rich 1
Horse(100146155) cysteine/histidine-rich 1
cow(282612) cysteine/histidine-rich 1
domestic cat(101081443) cysteine/histidine-rich 1
dog(609854) cysteine/histidine-rich 1
chicken(430740) cysteine/histidine-rich 1
sheep(101113858) cysteine/histidine-rich 1
naked mole-rat(101715143) cysteine/histidine-rich 1
domestic guinea pig(100715854) cysteine/histidine-rich 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019396 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019396 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019396 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032687 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032687 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032687 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU001141 MISSION® esiRNA esiRNA targeting mouse Cyhr1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032687 Rosetta Predictions human pricing
NM_019396 Rosetta Predictions mouse pricing
NM_180962 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032687 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175257 predicted 464
2 SASI_Hs01_00175258 predicted 497
3 SASI_Hs01_00175259 predicted 340
4 SASI_Hs01_00175260 predicted 461
5 SASI_Hs01_00175261 predicted 471
6 SASI_Hs01_00175262 predicted 324
7 SASI_Hs01_00175263 predicted 460
8 SASI_Hs01_00175264 predicted 338
9 SASI_Hs01_00175256 predicted 382
10 SASI_Hs01_00175265 predicted 344
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019396 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00024882 predicted 1243
2 SASI_Mm01_00024883 predicted 711
3 SASI_Mm01_00024884 predicted 417
4 SASI_Mm01_00024885 predicted 523
5 SASI_Mm01_00024887 predicted 747
6 SASI_Mm01_00024888 predicted 922
7 SASI_Mm01_00024889 predicted 866
8 SASI_Mm01_00024890 predicted 664
9 SASI_Mm01_00024891 predicted 938
10 SASI_Mm02_00324317 predicted 1151
11 SASI_Mm01_00024886 predicted 601
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_180962 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036430 predicted 656
2 SASI_Mm01_00036431 predicted 559
3 SASI_Mm01_00036432 predicted 710
4 SASI_Mm01_00036433 predicted 454
5 SASI_Mm02_00349584 predicted 866
6 SASI_Mm01_00036434 predicted 376
7 SASI_Mm01_00036435 predicted 797
8 SASI_Mm01_00036436 predicted 739
9 SASI_Mm01_00036437 predicted 913
10 SASI_Mm01_00036438 predicted 693
11 SASI_Mm01_00036439 predicted 518
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019396
VALIDATED
CYHR1 MISSION shRNA Bacterial Glycerol Stock
cysteine/histidine-rich 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196190    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019396.1-724s1c1
Sequence:CCGGGCAGCTCTACAACAGCATCTTCTCGAGAAGATGCTGTTGTAGAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019396.1-1129s1c1
Sequence:CCGGGAACATTAACCTGCGGCTCTTCTCGAGAAGAGCCGCAGGTTAATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184615    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019396.1-1241s1c1
Sequence:CCGGGCAGCAGCTTCACACAACTATCTCGAGATAGTTGTGTGAAGCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183441    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019396.1-1280s1c1
Sequence:CCGGGAGGAGAACAAACAGAATCAACTCGAGTTGATTCTGTTTGTTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019396.1-1021s1c1
Sequence:CCGGCAGTCCTGTTATCTACCACTTCTCGAGAAGTGGTAGATAACAGGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181205    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019396.1-1242s1c1
Sequence:CCGGCAGCAGCTTCACACAACTATACTCGAGTATAGTTGTGTGAAGCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292595    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019396.2-1242s21c1
Sequence:CCGGCAGCAGCTTCACACAACTATACTCGAGTATAGTTGTGTGAAGCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292596    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019396.2-1280s21c1
Sequence:CCGGGAGGAGAACAAACAGAATCAACTCGAGTTGATTCTGTTTGTTCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019396.2-1021s21c1
Sequence:CCGGCAGTCCTGTTATCTACCACTTCTCGAGAAGTGGTAGATAACAGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019396.2-1129s21c1
Sequence:CCGGGAACATTAACCTGCGGCTCTTCTCGAGAAGAGCCGCAGGTTAATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019396
VALIDATED
CYHR1 MISSION shRNA shRNA Plasmid DNA
cysteine/histidine-rich 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196190    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019396.1-724s1c1
Sequence:CCGGGCAGCTCTACAACAGCATCTTCTCGAGAAGATGCTGTTGTAGAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019396.1-1129s1c1
Sequence:CCGGGAACATTAACCTGCGGCTCTTCTCGAGAAGAGCCGCAGGTTAATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184615    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019396.1-1241s1c1
Sequence:CCGGGCAGCAGCTTCACACAACTATCTCGAGATAGTTGTGTGAAGCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183441    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019396.1-1280s1c1
Sequence:CCGGGAGGAGAACAAACAGAATCAACTCGAGTTGATTCTGTTTGTTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019396.1-1021s1c1
Sequence:CCGGCAGTCCTGTTATCTACCACTTCTCGAGAAGTGGTAGATAACAGGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181205    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019396.1-1242s1c1
Sequence:CCGGCAGCAGCTTCACACAACTATACTCGAGTATAGTTGTGTGAAGCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292595    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019396.2-1242s21c1
Sequence:CCGGCAGCAGCTTCACACAACTATACTCGAGTATAGTTGTGTGAAGCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292596    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019396.2-1280s21c1
Sequence:CCGGGAGGAGAACAAACAGAATCAACTCGAGTTGATTCTGTTTGTTCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019396.2-1021s21c1
Sequence:CCGGCAGTCCTGTTATCTACCACTTCTCGAGAAGTGGTAGATAACAGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019396.2-1129s21c1
Sequence:CCGGGAACATTAACCTGCGGCTCTTCTCGAGAAGAGCCGCAGGTTAATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019396
VALIDATED
CYHR1 MISSION shRNA Lentiviral Transduction Particles
cysteine/histidine-rich 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196190    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019396.1-724s1c1
Sequence:CCGGGCAGCTCTACAACAGCATCTTCTCGAGAAGATGCTGTTGTAGAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019396.1-1129s1c1
Sequence:CCGGGAACATTAACCTGCGGCTCTTCTCGAGAAGAGCCGCAGGTTAATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184615    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019396.1-1241s1c1
Sequence:CCGGGCAGCAGCTTCACACAACTATCTCGAGATAGTTGTGTGAAGCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183441    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019396.1-1280s1c1
Sequence:CCGGGAGGAGAACAAACAGAATCAACTCGAGTTGATTCTGTTTGTTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019396.1-1021s1c1
Sequence:CCGGCAGTCCTGTTATCTACCACTTCTCGAGAAGTGGTAGATAACAGGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181205    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019396.1-1242s1c1
Sequence:CCGGCAGCAGCTTCACACAACTATACTCGAGTATAGTTGTGTGAAGCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292595    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019396.2-1242s21c1
Sequence:CCGGCAGCAGCTTCACACAACTATACTCGAGTATAGTTGTGTGAAGCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292596    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019396.2-1280s21c1
Sequence:CCGGGAGGAGAACAAACAGAATCAACTCGAGTTGATTCTGTTTGTTCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019396.2-1021s21c1
Sequence:CCGGCAGTCCTGTTATCTACCACTTCTCGAGAAGTGGTAGATAACAGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019396.2-1129s21c1
Sequence:CCGGGAACATTAACCTGCGGCTCTTCTCGAGAAGAGCCGCAGGTTAATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032687
VALIDATED
CYHR1 MISSION shRNA Bacterial Glycerol Stock
cysteine/histidine-rich 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180050    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032687.2-540s1c1
Sequence:CCGGCTTCGATTTCCACTGGGTGAACTCGAGTTCACCCAGTGGAAATCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032687.2-703s1c1
Sequence:CCGGGTCTTCACGGCCAACACTTATCTCGAGATAAGTGTTGGCCGTGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032687.2-679s1c1
Sequence:CCGGGCAGTGACCATCCTCATTGTACTCGAGTACAATGAGGATGGTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032687.3-542s21c1
Sequence:CCGGTCGATTTCCACTGGGTGAATGCTCGAGCATTCACCCAGTGGAAATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254095    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032687.3-974s21c1
Sequence:CCGGTAGACTCTTCTGCCTACTGAACTCGAGTTCAGTAGGCAGAAGAGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032687.3-881s21c1
Sequence:CCGGGGGAGTGACAGTTGGATACAGCTCGAGCTGTATCCAACTGTCACTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032687.3-703s21c1
Sequence:CCGGGTCTTCACGGCCAACACTTATCTCGAGATAAGTGTTGGCCGTGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032687.3-677s21c1
Sequence:CCGGTCGCAGTGACCATCCTCATTGCTCGAGCAATGAGGATGGTCACTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032687
VALIDATED
CYHR1 MISSION shRNA shRNA Plasmid DNA
cysteine/histidine-rich 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180050    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032687.2-540s1c1
Sequence:CCGGCTTCGATTTCCACTGGGTGAACTCGAGTTCACCCAGTGGAAATCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032687.2-703s1c1
Sequence:CCGGGTCTTCACGGCCAACACTTATCTCGAGATAAGTGTTGGCCGTGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032687.2-679s1c1
Sequence:CCGGGCAGTGACCATCCTCATTGTACTCGAGTACAATGAGGATGGTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032687.3-542s21c1
Sequence:CCGGTCGATTTCCACTGGGTGAATGCTCGAGCATTCACCCAGTGGAAATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254095    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032687.3-974s21c1
Sequence:CCGGTAGACTCTTCTGCCTACTGAACTCGAGTTCAGTAGGCAGAAGAGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032687.3-881s21c1
Sequence:CCGGGGGAGTGACAGTTGGATACAGCTCGAGCTGTATCCAACTGTCACTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032687.3-703s21c1
Sequence:CCGGGTCTTCACGGCCAACACTTATCTCGAGATAAGTGTTGGCCGTGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032687.3-677s21c1
Sequence:CCGGTCGCAGTGACCATCCTCATTGCTCGAGCAATGAGGATGGTCACTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032687
VALIDATED
CYHR1 MISSION shRNA Lentiviral Transduction Particles
cysteine/histidine-rich 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180050    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032687.2-540s1c1
Sequence:CCGGCTTCGATTTCCACTGGGTGAACTCGAGTTCACCCAGTGGAAATCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032687.2-703s1c1
Sequence:CCGGGTCTTCACGGCCAACACTTATCTCGAGATAAGTGTTGGCCGTGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032687.2-679s1c1
Sequence:CCGGGCAGTGACCATCCTCATTGTACTCGAGTACAATGAGGATGGTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032687.3-542s21c1
Sequence:CCGGTCGATTTCCACTGGGTGAATGCTCGAGCATTCACCCAGTGGAAATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254095    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032687.3-974s21c1
Sequence:CCGGTAGACTCTTCTGCCTACTGAACTCGAGTTCAGTAGGCAGAAGAGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032687.3-881s21c1
Sequence:CCGGGGGAGTGACAGTTGGATACAGCTCGAGCTGTATCCAACTGTCACTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032687.3-703s21c1
Sequence:CCGGGTCTTCACGGCCAACACTTATCTCGAGATAAGTGTTGGCCGTGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032687.3-677s21c1
Sequence:CCGGTCGCAGTGACCATCCTCATTGCTCGAGCAATGAGGATGGTCACTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks