EMAIL THIS PAGE TO A FRIEND

CYLC1

cylicin, basic protein of sperm head cytoskeleton 1

84 Gene Product Result for
Synonyms: CYCL1
UniProtKB ID: P35663, A0AVQ8, Q5JQQ9
Gene ID:
Human(1538) Summary: This gene encodes a sperm head cytoskeletal protein. The encoded protein is associated with the calyx of spermatozoa and spermatids. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
Mouse(67407) cylicin, basic protein of sperm head cytoskeleton 1
Rat(100359483) cylicin, basic protein of sperm head cytoskeleton 1
domestic cat(101096791) cylicin, basic protein of sperm head cytoskeleton 1
cow(281737) cylicin, basic protein of sperm head cytoskeleton 1
dog(100684981) cylicin, basic protein of sperm head cytoskeleton 1
sheep(101121662) cylicin, basic protein of sperm head cytoskeleton 1
domestic guinea pig(100732207) cylicin, basic protein of sperm head cytoskeleton 1
naked mole-rat(101709843) cylicin, basic protein of sperm head cytoskeleton 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026134 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026134 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026134 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021118 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021118 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021118 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU056451 MISSION® esiRNA esiRNA human CYLC1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021118 Rosetta Predictions human pricing
XM_088636 Rosetta Predictions human pricing
XM_931141 Rosetta Predictions human pricing
XM_931154 Rosetta Predictions human pricing
NM_026134 Rosetta Predictions mouse pricing
XM_909141 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021118 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354619 predicted 544
2 SASI_Hs02_00354620 predicted 678
3 SASI_Hs02_00354621 predicted 222
4 SASI_Hs02_00354622 predicted 708
5 SASI_Hs02_00354623 predicted 310
6 SASI_Hs02_00354624 predicted 1641
7 SASI_Hs02_00354625 predicted 1745
8 SASI_Hs02_00354626 predicted 1734
9 SASI_Hs02_00354627 predicted 237
10 SASI_Hs02_00354628 predicted 228
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_088636 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00268234 predicted 568
2 SASI_Hs01_00268235 predicted 197
3 SASI_Hs01_00268236 predicted 701
4 SASI_Hs01_00268237 predicted 239
5 SASI_Hs01_00268238 predicted 789
6 SASI_Hs01_00268239 predicted 668
7 SASI_Hs01_00268240 predicted 753
8 SASI_Hs01_00268241 predicted 734
9 SASI_Hs01_00268242 predicted 1735
10 SASI_Hs01_00268243 predicted 461
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931141 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00256555 predicted 100
2 SASI_Hs01_00256556 predicted 298
3 SASI_Hs01_00256557 predicted 156
4 SASI_Hs01_00256558 predicted 270
5 SASI_Hs01_00256559 predicted 246
6 SASI_Hs01_00256560 predicted 131
7 SASI_Hs01_00256561 predicted 36
8 SASI_Hs01_00256562 predicted 191
9 SASI_Hs01_00256563 predicted 256
10 SASI_Hs01_00256564 predicted 265
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931154 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00250954 predicted 563
2 SASI_Hs01_00250955 predicted 198
3 SASI_Hs01_00250956 predicted 701
4 SASI_Hs01_00250957 predicted 234
5 SASI_Hs01_00250958 predicted 790
6 SASI_Hs01_00250959 predicted 661
7 SASI_Hs01_00250960 predicted 759
8 SASI_Hs01_00250961 predicted 732
9 SASI_Hs01_00250962 predicted 1740
10 SASI_Hs01_00250963 predicted 465
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026134 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00329731 predicted 787
2 SASI_Mm02_00329732 predicted 376
3 SASI_Mm02_00329733 predicted 386
4 SASI_Mm02_00329734 predicted 806
5 SASI_Mm02_00329735 predicted 737
6 SASI_Mm02_00329736 predicted 540
7 SASI_Mm02_00329737 predicted 817
8 SASI_Mm02_00329738 predicted 842
9 SASI_Mm02_00329739 predicted 301
10 SASI_Mm02_00329740 predicted 607
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_909141 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00280644 predicted 792
2 SASI_Mm01_00280645 predicted 383
3 SASI_Mm01_00280646 predicted 385
4 SASI_Mm01_00280647 predicted 815
5 SASI_Mm01_00280648 predicted 736
6 SASI_Mm01_00280649 predicted 547
7 SASI_Mm01_00280650 predicted 820
8 SASI_Mm01_00280651 predicted 848
9 SASI_Mm01_00280652 predicted 316
10 SASI_Mm01_00280653 predicted 621
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026134
CYLC1 MISSION shRNA Bacterial Glycerol Stock
cylicin, basic protein of sperm head cytoskeleton 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026134.2-494s21c1
Sequence:CCGGATAAGCTCATGTGTAGTAAATCTCGAGATTTACTACACATGAGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026134.2-304s21c1
Sequence:CCGGACCAACTCACGTATGGATAAACTCGAGTTTATCCATACGTGAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026134.2-826s21c1
Sequence:CCGGGGATTTAATGTTGCGTCTAAACTCGAGTTTAGACGCAACATTAAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026134.2-604s21c1
Sequence:CCGGATTGCCTAAGACGTCAAATTCCTCGAGGAATTTGACGTCTTAGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026134.2-1235s21c1
Sequence:CCGGGTAGATTCAAAGAGTACAAATCTCGAGATTTGTACTCTTTGAATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026134
CYLC1 MISSION shRNA shRNA Plasmid DNA
cylicin, basic protein of sperm head cytoskeleton 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026134.2-494s21c1
Sequence:CCGGATAAGCTCATGTGTAGTAAATCTCGAGATTTACTACACATGAGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026134.2-304s21c1
Sequence:CCGGACCAACTCACGTATGGATAAACTCGAGTTTATCCATACGTGAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026134.2-826s21c1
Sequence:CCGGGGATTTAATGTTGCGTCTAAACTCGAGTTTAGACGCAACATTAAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026134.2-604s21c1
Sequence:CCGGATTGCCTAAGACGTCAAATTCCTCGAGGAATTTGACGTCTTAGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026134.2-1235s21c1
Sequence:CCGGGTAGATTCAAAGAGTACAAATCTCGAGATTTGTACTCTTTGAATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026134
CYLC1 MISSION shRNA Lentiviral Transduction Particles
cylicin, basic protein of sperm head cytoskeleton 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026134.2-494s21c1
Sequence:CCGGATAAGCTCATGTGTAGTAAATCTCGAGATTTACTACACATGAGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026134.2-304s21c1
Sequence:CCGGACCAACTCACGTATGGATAAACTCGAGTTTATCCATACGTGAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026134.2-826s21c1
Sequence:CCGGGGATTTAATGTTGCGTCTAAACTCGAGTTTAGACGCAACATTAAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026134.2-604s21c1
Sequence:CCGGATTGCCTAAGACGTCAAATTCCTCGAGGAATTTGACGTCTTAGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026134.2-1235s21c1
Sequence:CCGGGTAGATTCAAAGAGTACAAATCTCGAGATTTGTACTCTTTGAATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021118
CYLC1 MISSION shRNA Bacterial Glycerol Stock
cylicin, basic protein of sperm head cytoskeleton 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021118.1-169s21c1
Sequence:CCGGAGACCTTTGAAATCACAAATACTCGAGTATTTGTGATTTCAAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021118.1-1653s21c1
Sequence:CCGGATCTGAAGAGTCACTATATAACTCGAGTTATATAGTGACTCTTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021118.1-1479s21c1
Sequence:CCGGGGAATCTGATTTGGAGTTAAACTCGAGTTTAACTCCAAATCAGATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021118.1-780s21c1
Sequence:CCGGGTCTGATGATGAATCCATAAACTCGAGTTTATGGATTCATCATCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021118.1-139s21c1
Sequence:CCGGCCACTCCAGAGAGGTACAAATCTCGAGATTTGTACCTCTCTGGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021118
CYLC1 MISSION shRNA shRNA Plasmid DNA
cylicin, basic protein of sperm head cytoskeleton 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021118.1-169s21c1
Sequence:CCGGAGACCTTTGAAATCACAAATACTCGAGTATTTGTGATTTCAAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021118.1-1653s21c1
Sequence:CCGGATCTGAAGAGTCACTATATAACTCGAGTTATATAGTGACTCTTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021118.1-1479s21c1
Sequence:CCGGGGAATCTGATTTGGAGTTAAACTCGAGTTTAACTCCAAATCAGATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021118.1-780s21c1
Sequence:CCGGGTCTGATGATGAATCCATAAACTCGAGTTTATGGATTCATCATCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021118.1-139s21c1
Sequence:CCGGCCACTCCAGAGAGGTACAAATCTCGAGATTTGTACCTCTCTGGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021118
CYLC1 MISSION shRNA Lentiviral Transduction Particles
cylicin, basic protein of sperm head cytoskeleton 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021118.1-169s21c1
Sequence:CCGGAGACCTTTGAAATCACAAATACTCGAGTATTTGTGATTTCAAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021118.1-1653s21c1
Sequence:CCGGATCTGAAGAGTCACTATATAACTCGAGTTATATAGTGACTCTTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021118.1-1479s21c1
Sequence:CCGGGGAATCTGATTTGGAGTTAAACTCGAGTTTAACTCCAAATCAGATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021118.1-780s21c1
Sequence:CCGGGTCTGATGATGAATCCATAAACTCGAGTTTATGGATTCATCATCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021118.1-139s21c1
Sequence:CCGGCCACTCCAGAGAGGTACAAATCTCGAGATTTGTACCTCTCTGGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks