EMAIL THIS PAGE TO A FRIEND

CYLC2

cylicin, basic protein of sperm head cytoskeleton 2

31 Gene Product Result for
UniProtKB ID: Q14093, B2R8F4, Q5VVJ9
Gene ID:
Human(1539) Summary: Cylicin II (CYCL2) is specifically expressed in testis and is part of the cytoskeletal calyx of mammalian sperm heads. Cylicin II may play a role in the morphogenesis of the sperm head. [provided by RefSeq, Jul 2008]
Mouse(74914) cylicin, basic protein of sperm head cytoskeleton 2
Rat(500458) cylicin, basic protein of sperm head cytoskeleton 2
naked mole-rat(101710072) cylicin, basic protein of sperm head cytoskeleton 2
domestic guinea pig(100717747) cylicin, basic protein of sperm head cytoskeleton 2
sheep(101120048) cylicin, basic protein of sperm head cytoskeleton 2
cow(281738) cylicin, basic protein of sperm head cytoskeleton 2
domestic cat(101098750) cylicin, basic protein of sperm head cytoskeleton 2
dog(612232) cylicin, basic protein of sperm head cytoskeleton 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1408924 Anti-CYLC2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
AV53587 Anti-CYLC2 antibody produced in rabbit affinity isolated antibody horse, human, rabbit, bovine, rat, guinea pig,
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001340 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001340 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001340 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU138821 MISSION® esiRNA esiRNA human CYLC2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001340 Rosetta Predictions human pricing
XM_575822 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001340 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136340 predicted 229
2 SASI_Hs01_00136341 predicted 194
3 SASI_Hs01_00136343 predicted 1256
4 SASI_Hs02_00331661 predicted 228
5 SASI_Hs01_00136344 predicted 24
6 SASI_Hs01_00136345 predicted 165
7 SASI_Hs01_00136346 predicted 86
8 SASI_Hs02_00331662 predicted 1258
9 SASI_Hs01_00136347 predicted 216
10 SASI_Hs01_00136348 predicted 244
11 SASI_Hs01_00136342 predicted 1272
12 SASI_Hs01_00136349 predicted 210
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575822 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00186188 predicted 1571
2 SASI_Rn01_00186189 predicted 1481
3 SASI_Rn01_00186190 predicted 772
4 SASI_Rn01_00186191 predicted 1346
5 SASI_Rn01_00186192 predicted 1588
6 SASI_Rn01_00186193 predicted 1417
7 SASI_Rn01_00186194 predicted 1250
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001340
CYLC2 MISSION shRNA Bacterial Glycerol Stock
cylicin, basic protein of sperm head cytoskeleton 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145564    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001340.1-429s1c1
Sequence:CCGGGAAAGGCAAGGATATAGAGAACTCGAGTTCTCTATATCCTTGCCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001340.1-209s1c1
Sequence:CCGGGAGATCGTAGACAACCATTATCTCGAGATAATGGTTGTCTACGATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145246    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001340.1-913s1c1
Sequence:CCGGGCCAAGAAAGATACTGAGAAACTCGAGTTTCTCAGTATCTTTCTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001340.1-58s1c1
Sequence:CCGGCCAGTCAGTGAATTAAGCAAACTCGAGTTTGCTTAATTCACTGACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121610    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001340.1-1658s1c1
Sequence:CCGGGCCTACATCTTTCTTTCTGAACTCGAGTTCAGAAAGAAAGATGTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001340.1-836s1c1
Sequence:CCGGGTAGTACAGACAGTGACTCAACTCGAGTTGAGTCACTGTCTGTACTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001340.1-769s1c1
Sequence:CCGGGAATCGAAGGATGCCAAGAAACTCGAGTTTCTTGGCATCCTTCGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141372    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001340.1-1944s1c1
Sequence:CCGGCGTGAGGATGGATTGGACATTCTCGAGAATGTCCAATCCATCCTCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001340.1-166s1c1
Sequence:CCGGCGGGACAACACGGTTTCTATACTCGAGTATAGAAACCGTGTTGTCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001340.1-940s1c1
Sequence:CCGGGCTGATTCAAAGAAGGATGCACTCGAGTGCATCCTTCTTTGAATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142640    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001340.1-1766s1c1
Sequence:CCGGGCTGGAGTTCAGTGACATGATCTCGAGATCATGTCACTGAACTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001340
CYLC2 MISSION shRNA shRNA Plasmid DNA
cylicin, basic protein of sperm head cytoskeleton 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145564    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001340.1-429s1c1
Sequence:CCGGGAAAGGCAAGGATATAGAGAACTCGAGTTCTCTATATCCTTGCCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001340.1-209s1c1
Sequence:CCGGGAGATCGTAGACAACCATTATCTCGAGATAATGGTTGTCTACGATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145246    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001340.1-913s1c1
Sequence:CCGGGCCAAGAAAGATACTGAGAAACTCGAGTTTCTCAGTATCTTTCTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001340.1-58s1c1
Sequence:CCGGCCAGTCAGTGAATTAAGCAAACTCGAGTTTGCTTAATTCACTGACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121610    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001340.1-1658s1c1
Sequence:CCGGGCCTACATCTTTCTTTCTGAACTCGAGTTCAGAAAGAAAGATGTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001340.1-836s1c1
Sequence:CCGGGTAGTACAGACAGTGACTCAACTCGAGTTGAGTCACTGTCTGTACTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001340.1-769s1c1
Sequence:CCGGGAATCGAAGGATGCCAAGAAACTCGAGTTTCTTGGCATCCTTCGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141372    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001340.1-1944s1c1
Sequence:CCGGCGTGAGGATGGATTGGACATTCTCGAGAATGTCCAATCCATCCTCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001340.1-166s1c1
Sequence:CCGGCGGGACAACACGGTTTCTATACTCGAGTATAGAAACCGTGTTGTCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001340.1-940s1c1
Sequence:CCGGGCTGATTCAAAGAAGGATGCACTCGAGTGCATCCTTCTTTGAATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142640    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001340.1-1766s1c1
Sequence:CCGGGCTGGAGTTCAGTGACATGATCTCGAGATCATGTCACTGAACTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001340
CYLC2 MISSION shRNA Lentiviral Transduction Particles
cylicin, basic protein of sperm head cytoskeleton 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145564    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001340.1-429s1c1
Sequence:CCGGGAAAGGCAAGGATATAGAGAACTCGAGTTCTCTATATCCTTGCCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001340.1-209s1c1
Sequence:CCGGGAGATCGTAGACAACCATTATCTCGAGATAATGGTTGTCTACGATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145246    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001340.1-913s1c1
Sequence:CCGGGCCAAGAAAGATACTGAGAAACTCGAGTTTCTCAGTATCTTTCTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001340.1-58s1c1
Sequence:CCGGCCAGTCAGTGAATTAAGCAAACTCGAGTTTGCTTAATTCACTGACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121610    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001340.1-1658s1c1
Sequence:CCGGGCCTACATCTTTCTTTCTGAACTCGAGTTCAGAAAGAAAGATGTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001340.1-836s1c1
Sequence:CCGGGTAGTACAGACAGTGACTCAACTCGAGTTGAGTCACTGTCTGTACTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001340.1-769s1c1
Sequence:CCGGGAATCGAAGGATGCCAAGAAACTCGAGTTTCTTGGCATCCTTCGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141372    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001340.1-1944s1c1
Sequence:CCGGCGTGAGGATGGATTGGACATTCTCGAGAATGTCCAATCCATCCTCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001340.1-166s1c1
Sequence:CCGGCGGGACAACACGGTTTCTATACTCGAGTATAGAAACCGTGTTGTCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001340.1-940s1c1
Sequence:CCGGGCTGATTCAAAGAAGGATGCACTCGAGTGCATCCTTCTTTGAATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142640    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001340.1-1766s1c1
Sequence:CCGGGCTGGAGTTCAGTGACATGATCTCGAGATCATGTCACTGAACTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)