EMAIL THIS PAGE TO A FRIEND

CYLD

cylindromatosis (turban tumor syndrome)

254 Gene Product Result for
Synonyms: BRSS CDMT CYLD1 CYLDI EAC MFT MFT1 SBS TEM USPL2
UniProtKB ID: Q9NQC7, O94934, Q7L3N6, Q96EH0, Q9NZX9
Gene ID:
Human(1540) Summary: This gene is encodes a cytoplasmic protein with three cytoskeletal-associated protein-glycine-conserved (CAP-GLY) domains that functions as a deubiquitinating enzyme. Mutations in this gene have been associated with cylindromatosis, multiple familial trichoepithelioma, and Brooke-Spiegler syndrome. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Mouse(74256) cylindromatosis (turban tumor syndrome)
Rat(312937) cylindromatosis (turban tumor syndrome)
fruit fly(34380) cylindromatosis
chicken(415725) cylindromatosis (turban tumor syndrome)
domestic cat(101094641) cylindromatosis (turban tumor syndrome)
cow(536421) cylindromatosis (turban tumor syndrome)
Horse(100050308) cylindromatosis (turban tumor syndrome)
dog(611649) cylindromatosis (turban tumor syndrome)
sheep(101113429) cylindromatosis (turban tumor syndrome)
domestic guinea pig(100732328) cylindromatosis (turban tumor syndrome)
naked mole-rat(101707343) cylindromatosis (turban tumor syndrome)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4200061 Anti-CYLD (C-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB2500284 Anti-CYLD antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, rat
ELISA, western blot pricing
SAB1412420 ANTI-CYLD antibody produced in mouse clone 2G1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412421 ANTI-CYLD antibody produced in mouse clone 1E9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412422 ANTI-CYLD antibody produced in mouse clone 2F9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4200060 Anti-CYLD antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution human, rat, mouse
immunohistochemistry, western blot pricing
HPA050095 Anti-CYLD antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
WH0001540M1 Monoclonal Anti-CYLD antibody produced in mouse clone 2C3, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1403718 Monoclonal Anti-CYLD, (C-terminal) antibody produced in mouse clone 3A9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015247 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015247 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015247 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173369 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173369 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173369 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042355 Rosetta Predictions human pricing
NM_001042412 Rosetta Predictions human pricing
NM_015247 siRNAs that have been validated in the lab human pricing
NM_001017380 Rosetta Predictions rat pricing
XM_001058247 Rosetta Predictions rat pricing
XM_001062983 Rosetta Predictions rat pricing
XM_001063048 Rosetta Predictions rat pricing
XM_001063098 Rosetta Predictions rat pricing
NM_001128169 Rosetta Predictions mouse pricing
NM_001128170 Rosetta Predictions mouse pricing
NM_001128171 Rosetta Predictions mouse pricing
NM_173369 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042355 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309208 predicted 2149
2 SASI_Hs02_00309209 predicted 1505
3 SASI_Hs02_00309210 predicted 2069
4 SASI_Hs02_00309211 predicted 1540
5 SASI_Hs02_00309212 predicted 2454
6 SASI_Hs02_00309213 predicted 2047
7 SASI_Hs02_00309214 predicted 1961
8 SASI_Hs02_00309215 predicted 2781
9 SASI_Hs02_00309216 predicted 1531
10 SASI_Hs02_00309217 predicted 1928
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042412 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309598 predicted 2169
2 SASI_Hs02_00309599 predicted 1523
3 SASI_Hs02_00309600 predicted 2095
4 SASI_Hs02_00309601 predicted 1565
5 SASI_Hs02_00309602 predicted 2477
6 SASI_Hs02_00309603 predicted 2071
7 SASI_Hs02_00309604 predicted 1986
8 SASI_Hs02_00309605 predicted 2800
9 SASI_Hs02_00309606 predicted 1554
10 SASI_Hs02_00309607 predicted 1943
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015247 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177192 validated 1649
2 SASI_Hs01_00177191 predicted 2294
3 SASI_Hs01_00177193 predicted 2223
4 SASI_Hs01_00177195 predicted 1689
5 SASI_Hs01_00177196 predicted 2597
6 SASI_Hs02_00347383 predicted 2201
7 SASI_Hs01_00177197 predicted 2103
8 SASI_Hs02_00347384 predicted 2927
9 SASI_Hs02_00347385 predicted 1684
10 SASI_Hs01_00177199 predicted 2071
11 SASI_Hs01_00177194 predicted 1484
12 SASI_Hs01_00177198 predicted 2343
13 SASI_Hs01_00177200 predicted 2010
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017380 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202217 predicted 2076
2 SASI_Rn02_00202218 predicted 1970
3 SASI_Rn02_00202219 predicted 2034
4 SASI_Rn02_00202220 predicted 917
5 SASI_Rn02_00202221 predicted 2112
6 SASI_Rn02_00202222 predicted 1136
7 SASI_Rn02_00202223 predicted 1714
8 SASI_Rn02_00202224 predicted 1875
9 SASI_Rn02_00202225 predicted 893
10 SASI_Rn02_00202226 predicted 1988
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058247 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00289079 predicted 859
2 SASI_Rn02_00289080 predicted 1286
3 SASI_Rn02_00289081 predicted 753
4 SASI_Rn02_00289082 predicted 816
5 SASI_Rn02_00289083 predicted 893
6 SASI_Rn02_00289084 predicted 1812
7 SASI_Rn02_00289085 predicted 503
8 SASI_Rn02_00289086 predicted 661
9 SASI_Rn02_00289087 predicted 776
10 SASI_Rn02_00289088 predicted 921
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062983 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00305339 predicted 1919
2 SASI_Rn02_00305340 predicted 1817
3 SASI_Rn02_00305341 predicted 1883
4 SASI_Rn02_00305342 predicted 873
5 SASI_Rn02_00305343 predicted 1958
6 SASI_Rn02_00305344 predicted 2881
7 SASI_Rn02_00305345 predicted 1100
8 SASI_Rn02_00305346 predicted 1558
9 SASI_Rn02_00305347 predicted 1719
10 SASI_Rn02_00305348 predicted 850
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063048 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00305562 predicted 2111
2 SASI_Rn02_00305563 predicted 2006
3 SASI_Rn02_00305564 predicted 2071
4 SASI_Rn02_00305565 predicted 943
5 SASI_Rn02_00305566 predicted 2153
6 SASI_Rn02_00305567 predicted 3069
7 SASI_Rn02_00305568 predicted 1163
8 SASI_Rn02_00305569 predicted 1752
9 SASI_Rn02_00305570 predicted 1906
10 SASI_Rn02_00305571 predicted 917
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063098 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00305768 predicted 2100
2 SASI_Rn02_00305769 predicted 1991
3 SASI_Rn02_00305770 predicted 2059
4 SASI_Rn02_00305771 predicted 949
5 SASI_Rn02_00305772 predicted 2145
6 SASI_Rn02_00305773 predicted 3061
7 SASI_Rn02_00305774 predicted 1161
8 SASI_Rn02_00305775 predicted 1740
9 SASI_Rn02_00305776 predicted 1906
10 SASI_Rn02_00305777 predicted 914
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128169 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310588 predicted 2914
2 SASI_Mm02_00310589 predicted 2215
3 SASI_Mm02_00310590 predicted 2117
4 SASI_Mm02_00310591 predicted 2097
5 SASI_Mm02_00310592 predicted 544
6 SASI_Mm02_00310593 predicted 1053
7 SASI_Mm02_00310594 predicted 2354
8 SASI_Mm02_00310595 predicted 2988
9 SASI_Mm02_00310596 predicted 2232
10 SASI_Mm02_00310597 predicted 2080
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128170 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310598 predicted 2704
2 SASI_Mm02_00310599 predicted 1999
3 SASI_Mm02_00310600 predicted 1905
4 SASI_Mm02_00310601 predicted 1882
5 SASI_Mm02_00310602 predicted 332
6 SASI_Mm02_00310603 predicted 840
7 SASI_Mm02_00310604 predicted 2144
8 SASI_Mm02_00310605 predicted 2777
9 SASI_Mm02_00310606 predicted 2020
10 SASI_Mm02_00310607 predicted 1867
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128171 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310608 predicted 2835
2 SASI_Mm02_00310609 predicted 2128
3 SASI_Mm02_00310610 predicted 2036
4 SASI_Mm02_00310611 predicted 2012
5 SASI_Mm02_00310612 predicted 463
6 SASI_Mm02_00310613 predicted 980
7 SASI_Mm02_00310614 predicted 2276
8 SASI_Mm02_00310615 predicted 2910
9 SASI_Mm02_00310616 predicted 2146
10 SASI_Mm02_00310617 predicted 1995
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173369 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059856 predicted 2697
2 SASI_Mm01_00059857 predicted 1987
3 SASI_Mm01_00059858 predicted 1894
4 SASI_Mm01_00059859 predicted 1875
5 SASI_Mm01_00059860 predicted 334
6 SASI_Mm01_00059861 predicted 839
7 SASI_Mm01_00059862 predicted 2141
8 SASI_Mm01_00059863 predicted 2770
9 SASI_Mm01_00059865 predicted 2019
10 SASI_Mm02_00345180 predicted 1858
11 SASI_Mm01_00059864 predicted 2331
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015247
CYLD MISSION shRNA Bacterial Glycerol Stock
cylindromatosis (turban tumor syndrome)
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015247.1-1669s1c1
Sequence:CCGGGCCCAATACCAATGGAAGTATCTCGAGATACTTCCATTGGTATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039628    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015247.1-4219s1c1
Sequence:CCGGCCCATTAAATTCAGTGTAGTTCTCGAGAACTACACTGAATTTAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015247.1-474s1c1
Sequence:CCGGGCAGCGTTACAGACAAACAAACTCGAGTTTGTTTGTCTGTAACGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015247.1-2059s1c1
Sequence:CCGGGCGCTGTAACTCTTTAGCATTCTCGAGAATGCTAAAGAGTTACAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015247.1-2573s1c1
Sequence:CCGGCCCACAATTCAGCAGTTGTTACTCGAGTAACAACTGCTGAATTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015247.x-3218s1c1
Sequence:CCGGTATATGTGCATGTACCAGAGTCTCGAGACTCTGGTACATGCACATATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010488    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015247.x-5274s1c1
Sequence:CCGGCATCTTCAGATGTTGGTATCTCTCGAGAGATACCAACATCTGAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015247.x-896s1c1
Sequence:CCGGAAGAAGGTCGTGGTCAAGGTCTCGAGACCTTGACCACGACCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230281    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015247.2-3959s21c1
Sequence:CCGGCCTGGAGGATTAGGGTATTTACTCGAGTAAATACCCTAATCCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015247.2-1402s21c1
Sequence:GTACCGGAGGTTCATCCAGTCATAATAACTCGAGTTATTATGACTGGATGAACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015247.2-2219s21c1
Sequence:CCGGTACTTAGACTCAACCTTATTCCTCGAGGAATAAGGTTGAGTCTAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015247.2-1300s21c1
Sequence:CCGGTCTATTGCACATCAATGATATCTCGAGATATCATTGATGTGCAATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015247.2-880s21c1
Sequence:CCGGGAGGACAGTCTCCGGAATATTCTCGAGAATATTCCGGAGACTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015247
CYLD MISSION shRNA shRNA Plasmid DNA
cylindromatosis (turban tumor syndrome)
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015247.1-1669s1c1
Sequence:CCGGGCCCAATACCAATGGAAGTATCTCGAGATACTTCCATTGGTATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039628    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015247.1-4219s1c1
Sequence:CCGGCCCATTAAATTCAGTGTAGTTCTCGAGAACTACACTGAATTTAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015247.1-474s1c1
Sequence:CCGGGCAGCGTTACAGACAAACAAACTCGAGTTTGTTTGTCTGTAACGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015247.1-2059s1c1
Sequence:CCGGGCGCTGTAACTCTTTAGCATTCTCGAGAATGCTAAAGAGTTACAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015247.1-2573s1c1
Sequence:CCGGCCCACAATTCAGCAGTTGTTACTCGAGTAACAACTGCTGAATTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015247.x-3218s1c1
Sequence:CCGGTATATGTGCATGTACCAGAGTCTCGAGACTCTGGTACATGCACATATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010488    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015247.x-5274s1c1
Sequence:CCGGCATCTTCAGATGTTGGTATCTCTCGAGAGATACCAACATCTGAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015247.x-896s1c1
Sequence:CCGGAAGAAGGTCGTGGTCAAGGTCTCGAGACCTTGACCACGACCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230281    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015247.2-3959s21c1
Sequence:CCGGCCTGGAGGATTAGGGTATTTACTCGAGTAAATACCCTAATCCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015247.2-1402s21c1
Sequence:GTACCGGAGGTTCATCCAGTCATAATAACTCGAGTTATTATGACTGGATGAACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015247.2-2219s21c1
Sequence:CCGGTACTTAGACTCAACCTTATTCCTCGAGGAATAAGGTTGAGTCTAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015247.2-1300s21c1
Sequence:CCGGTCTATTGCACATCAATGATATCTCGAGATATCATTGATGTGCAATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015247.2-880s21c1
Sequence:CCGGGAGGACAGTCTCCGGAATATTCTCGAGAATATTCCGGAGACTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015247
CYLD MISSION shRNA Lentiviral Transduction Particles
cylindromatosis (turban tumor syndrome)
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015247.1-1669s1c1
Sequence:CCGGGCCCAATACCAATGGAAGTATCTCGAGATACTTCCATTGGTATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039628    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015247.1-4219s1c1
Sequence:CCGGCCCATTAAATTCAGTGTAGTTCTCGAGAACTACACTGAATTTAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015247.1-474s1c1
Sequence:CCGGGCAGCGTTACAGACAAACAAACTCGAGTTTGTTTGTCTGTAACGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015247.1-2059s1c1
Sequence:CCGGGCGCTGTAACTCTTTAGCATTCTCGAGAATGCTAAAGAGTTACAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015247.1-2573s1c1
Sequence:CCGGCCCACAATTCAGCAGTTGTTACTCGAGTAACAACTGCTGAATTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015247.x-3218s1c1
Sequence:CCGGTATATGTGCATGTACCAGAGTCTCGAGACTCTGGTACATGCACATATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010488    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015247.x-5274s1c1
Sequence:CCGGCATCTTCAGATGTTGGTATCTCTCGAGAGATACCAACATCTGAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015247.x-896s1c1
Sequence:CCGGAAGAAGGTCGTGGTCAAGGTCTCGAGACCTTGACCACGACCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230281    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015247.2-3959s21c1
Sequence:CCGGCCTGGAGGATTAGGGTATTTACTCGAGTAAATACCCTAATCCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015247.2-1402s21c1
Sequence:GTACCGGAGGTTCATCCAGTCATAATAACTCGAGTTATTATGACTGGATGAACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015247.2-2219s21c1
Sequence:CCGGTACTTAGACTCAACCTTATTCCTCGAGGAATAAGGTTGAGTCTAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015247.2-1300s21c1
Sequence:CCGGTCTATTGCACATCAATGATATCTCGAGATATCATTGATGTGCAATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015247.2-880s21c1
Sequence:CCGGGAGGACAGTCTCCGGAATATTCTCGAGAATATTCCGGAGACTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173369
VALIDATED
CYLD MISSION shRNA Bacterial Glycerol Stock
cylindromatosis (turban tumor syndrome)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173369.1-1807s1c1
Sequence:CCGGGCAGCCTGTTTCCAATCAAATCTCGAGATTTGATTGGAAACAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173369.1-2010s1c1
Sequence:CCGGCCCTGGACACTGTGTTACTTACTCGAGTAAGTAACACAGTGTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173369.1-767s1c1
Sequence:CCGGGCATTGGACAAACTAGAACTTCTCGAGAAGTTCTAGTTTGTCCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173369.1-1441s1c1
Sequence:CCGGGCCCAATACTAATGGCAGCATCTCGAGATGCTGCCATTAGTATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173369.1-2356s1c1
Sequence:CCGGGCAGTTATTAGAATGGTCTTTCTCGAGAAAGACCATTCTAATAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173369.2-542s21c1
Sequence:CCGGAGGAGAGGCTCAGCCTATTTACTCGAGTAAATAGGCTGAGCCTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173369.2-2340s21c1
Sequence:CCGGAGACTGTAACTTCTATCAAATCTCGAGATTTGATAGAAGTTACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173369.2-2011s21c1
Sequence:CCGGTGTTACTTAGACTCAACTTTACTCGAGTAAAGTTGAGTCTAAGTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173369
VALIDATED
CYLD MISSION shRNA shRNA Plasmid DNA
cylindromatosis (turban tumor syndrome)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173369.1-1807s1c1
Sequence:CCGGGCAGCCTGTTTCCAATCAAATCTCGAGATTTGATTGGAAACAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173369.1-2010s1c1
Sequence:CCGGCCCTGGACACTGTGTTACTTACTCGAGTAAGTAACACAGTGTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173369.1-767s1c1
Sequence:CCGGGCATTGGACAAACTAGAACTTCTCGAGAAGTTCTAGTTTGTCCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173369.1-1441s1c1
Sequence:CCGGGCCCAATACTAATGGCAGCATCTCGAGATGCTGCCATTAGTATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173369.1-2356s1c1
Sequence:CCGGGCAGTTATTAGAATGGTCTTTCTCGAGAAAGACCATTCTAATAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173369.2-542s21c1
Sequence:CCGGAGGAGAGGCTCAGCCTATTTACTCGAGTAAATAGGCTGAGCCTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173369.2-2340s21c1
Sequence:CCGGAGACTGTAACTTCTATCAAATCTCGAGATTTGATAGAAGTTACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173369.2-2011s21c1
Sequence:CCGGTGTTACTTAGACTCAACTTTACTCGAGTAAAGTTGAGTCTAAGTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173369
VALIDATED
CYLD MISSION shRNA Lentiviral Transduction Particles
cylindromatosis (turban tumor syndrome)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173369.1-1807s1c1
Sequence:CCGGGCAGCCTGTTTCCAATCAAATCTCGAGATTTGATTGGAAACAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173369.1-2010s1c1
Sequence:CCGGCCCTGGACACTGTGTTACTTACTCGAGTAAGTAACACAGTGTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173369.1-767s1c1
Sequence:CCGGGCATTGGACAAACTAGAACTTCTCGAGAAGTTCTAGTTTGTCCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173369.1-1441s1c1
Sequence:CCGGGCCCAATACTAATGGCAGCATCTCGAGATGCTGCCATTAGTATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173369.1-2356s1c1
Sequence:CCGGGCAGTTATTAGAATGGTCTTTCTCGAGAAAGACCATTCTAATAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173369.2-542s21c1
Sequence:CCGGAGGAGAGGCTCAGCCTATTTACTCGAGTAAATAGGCTGAGCCTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173369.2-2340s21c1
Sequence:CCGGAGACTGTAACTTCTATCAAATCTCGAGATTTGATAGAAGTTACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173369.2-2011s21c1
Sequence:CCGGTGTTACTTAGACTCAACTTTACTCGAGTAAAGTTGAGTCTAAGTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks