EMAIL THIS PAGE TO A FRIEND

CYP11A1

cytochrome P450, family 11, subfamily A, polypeptide 1

70 Gene Product Result for
Synonyms: CYP11A CYPXIA1 P450SCC
Gene ID:
Human(1583) Summary: This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the mitochondrial inner membrane and catalyzes the conversion of cholesterol to pregnenolone, the first and rate-limiting step in the synthesis of the steroid hormones. Two transcript variants encoding different isoforms have been found for this gene. The cellular location of the smaller isoform is unclear since it lacks the mitochondrial-targeting transit peptide. [provided by RefSeq, Jul 2008]
Mouse(13070) cytochrome P450, family 11, subfamily a, polypeptide 1
Rat(29680) cytochrome P450, family 11, subfamily a, polypeptide 1
Zebrafish(80374) cytochrome P450, subfamily XIA, polypeptide 1
cow(338048) cytochrome P450, family 11, subfamily A, polypeptide 1
Horse(100034229) cytochrome P450 cholesterol side-chain cleavage
dog(478365) cytochrome P450, family 11, subfamily A, polypeptide 1
chicken(414838) cytochrome P450, family 11, subfamily A, polypeptide 1
sheep(100048994) cytochrome P450, family 11, subfamily A, polypeptide 1
Domestic Rabbit(100345737) cytochrome P450, family 11, subfamily A, polypeptide 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019779 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019779 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019779 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000781 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000781 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000781 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000781 Rosetta Predictions human pricing
NM_001099773 Rosetta Predictions human pricing
NM_017286 Rosetta Predictions rat pricing
NM_019779 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000781 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231660 predicted 1637
2 SASI_Hs01_00231662 predicted 744
3 SASI_Hs01_00231665 predicted 1401
4 SASI_Hs01_00231667 predicted 1075
5 SASI_Hs02_00303216 predicted 1591
6 SASI_Hs02_00303217 predicted 1287
7 SASI_Hs02_00303218 predicted 948
8 SASI_Hs02_00303219 predicted 1178
9 SASI_Hs01_00231669 predicted 1000
10 SASI_Hs02_00303220 predicted 1627
11 SASI_Hs01_00231661 predicted 251
12 SASI_Hs01_00231663 predicted 258
13 SASI_Hs01_00231664 predicted 203
14 SASI_Hs01_00231666 predicted 350
15 SASI_Hs01_00231668 predicted 1488
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099773 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321388 predicted 1706
2 SASI_Hs02_00321389 predicted 823
3 SASI_Hs02_00321390 predicted 1474
4 SASI_Hs02_00321391 predicted 1148
5 SASI_Hs02_00321392 predicted 1663
6 SASI_Hs02_00321393 predicted 1357
7 SASI_Hs02_00321394 predicted 1028
8 SASI_Hs02_00321395 predicted 1256
9 SASI_Hs02_00321396 predicted 1074
10 SASI_Hs02_00321397 predicted 1700
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017286 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00122337 predicted 265
2 SASI_Rn02_00261713 predicted 441
3 SASI_Rn01_00122338 predicted 331
4 SASI_Rn01_00122339 predicted 870
5 SASI_Rn01_00122341 predicted 1018
6 SASI_Rn01_00122342 predicted 728
7 SASI_Rn02_00261714 predicted 836
8 SASI_Rn01_00122343 predicted 1174
9 SASI_Rn02_00261715 predicted 431
10 SASI_Rn01_00122346 predicted 1275
11 SASI_Rn01_00122340 predicted 953
12 SASI_Rn01_00122344 predicted 797
13 SASI_Rn01_00122345 predicted 1308
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019779 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151510 predicted 286
2 SASI_Mm01_00151511 predicted 605
3 SASI_Mm01_00151512 predicted 857
4 SASI_Mm02_00324978 predicted 840
5 SASI_Mm02_00324979 predicted 854
6 SASI_Mm01_00151513 predicted 1032
7 SASI_Mm01_00151514 predicted 395
8 SASI_Mm01_00151516 predicted 1102
9 SASI_Mm01_00151517 predicted 1294
10 SASI_Mm02_00324980 predicted 846
11 SASI_Mm01_00151515 predicted 213
12 SASI_Mm01_00151518 predicted 805
13 SASI_Mm01_00151519 predicted 1139
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019779
VALIDATED
CYP11A1 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 11, subfamily A, polypeptide 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019779.2-1034s1c1
Sequence:CCGGGCAGTGGAACCTTTATGAGATCTCGAGATCTCATAAAGGTTCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173193    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019779.2-1684s1c1
Sequence:CCGGCAGAAACAGCACTCTGTGATTCTCGAGAATCACAGAGTGCTGTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215627    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019779.3-637s1c1
Sequence:CCGGGTCCATCAGCAGTGTTATATTCTCGAGAATATAACACTGCTGATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019779.3-457s21c1
Sequence:CCGGGAAAGACCGAATCGTCCTAAACTCGAGTTTAGGACGATTCGGTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019779.3-1210s21c1
Sequence:CCGGTGACCTGGTGCTTCGTAATTACTCGAGTAATTACGAAGCACCAGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019779.3-391s21c1
Sequence:CCGGGGTGGCCTATCACCAGTATTACTCGAGTAATACTGGTGATAGGCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019779.3-175s21c1
Sequence:CCGGTGGCGACAATGGTTGGCTAAACTCGAGTTTAGCCAACCATTGTCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019779.3-637s21c1
Sequence:CCGGGTCCATCAGCAGTGTTATATTCTCGAGAATATAACACTGCTGATGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019779
VALIDATED
CYP11A1 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 11, subfamily A, polypeptide 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019779.2-1034s1c1
Sequence:CCGGGCAGTGGAACCTTTATGAGATCTCGAGATCTCATAAAGGTTCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173193    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019779.2-1684s1c1
Sequence:CCGGCAGAAACAGCACTCTGTGATTCTCGAGAATCACAGAGTGCTGTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215627    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019779.3-637s1c1
Sequence:CCGGGTCCATCAGCAGTGTTATATTCTCGAGAATATAACACTGCTGATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019779.3-457s21c1
Sequence:CCGGGAAAGACCGAATCGTCCTAAACTCGAGTTTAGGACGATTCGGTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019779.3-1210s21c1
Sequence:CCGGTGACCTGGTGCTTCGTAATTACTCGAGTAATTACGAAGCACCAGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019779.3-391s21c1
Sequence:CCGGGGTGGCCTATCACCAGTATTACTCGAGTAATACTGGTGATAGGCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019779.3-175s21c1
Sequence:CCGGTGGCGACAATGGTTGGCTAAACTCGAGTTTAGCCAACCATTGTCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019779.3-637s21c1
Sequence:CCGGGTCCATCAGCAGTGTTATATTCTCGAGAATATAACACTGCTGATGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019779
VALIDATED
CYP11A1 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 11, subfamily A, polypeptide 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019779.2-1034s1c1
Sequence:CCGGGCAGTGGAACCTTTATGAGATCTCGAGATCTCATAAAGGTTCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173193    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019779.2-1684s1c1
Sequence:CCGGCAGAAACAGCACTCTGTGATTCTCGAGAATCACAGAGTGCTGTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215627    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019779.3-637s1c1
Sequence:CCGGGTCCATCAGCAGTGTTATATTCTCGAGAATATAACACTGCTGATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019779.3-457s21c1
Sequence:CCGGGAAAGACCGAATCGTCCTAAACTCGAGTTTAGGACGATTCGGTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019779.3-1210s21c1
Sequence:CCGGTGACCTGGTGCTTCGTAATTACTCGAGTAATTACGAAGCACCAGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019779.3-391s21c1
Sequence:CCGGGGTGGCCTATCACCAGTATTACTCGAGTAATACTGGTGATAGGCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019779.3-175s21c1
Sequence:CCGGTGGCGACAATGGTTGGCTAAACTCGAGTTTAGCCAACCATTGTCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019779.3-637s21c1
Sequence:CCGGGTCCATCAGCAGTGTTATATTCTCGAGAATATAACACTGCTGATGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000781
CYP11A1 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 11, subfamily A, polypeptide 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000781.1-887s1c1
Sequence:CCGGCCAGAACTTCTACTGGGAATTCTCGAGAATTCCCAGTAGAAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000781.1-290s1c1
Sequence:CCGGCCAGAAGTATGGCCCGATTTACTCGAGTAAATCGGGCCATACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000781.1-1364s1c1
Sequence:CCGGGCTGAGCAAAGACAAGAACATCTCGAGATGTTCTTGTCTTTGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000781.1-1500s1c1
Sequence:CCGGGAAATCCAACACCTCAGCGATCTCGAGATCGCTGAGGTGTTGGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000781.1-737s1c1
Sequence:CCGGGCGATTCATTGATGCCATCTACTCGAGTAGATGGCATCAATGAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000781.2-435s21c1
Sequence:CCGGGGCAACGTGGAGTCGGTTTATCTCGAGATAAACCGACTCCACGTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000781.2-330s21c1
Sequence:CCGGTGGCTAAACCTGTACCATTTCCTCGAGGAAATGGTACAGGTTTAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000781.2-1029s21c1
Sequence:CCGGGGAAGTGTTCACCACGATTACCTCGAGGTAATCGTGGTGAACACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000781.2-1679s21c1
Sequence:CCGGCTTCACCTTCTGGCCCTTTAACTCGAGTTAAAGGGCCAGAAGGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000781
CYP11A1 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 11, subfamily A, polypeptide 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000781.1-887s1c1
Sequence:CCGGCCAGAACTTCTACTGGGAATTCTCGAGAATTCCCAGTAGAAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000781.1-290s1c1
Sequence:CCGGCCAGAAGTATGGCCCGATTTACTCGAGTAAATCGGGCCATACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000781.1-1364s1c1
Sequence:CCGGGCTGAGCAAAGACAAGAACATCTCGAGATGTTCTTGTCTTTGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000781.1-1500s1c1
Sequence:CCGGGAAATCCAACACCTCAGCGATCTCGAGATCGCTGAGGTGTTGGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000781.1-737s1c1
Sequence:CCGGGCGATTCATTGATGCCATCTACTCGAGTAGATGGCATCAATGAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000781.2-435s21c1
Sequence:CCGGGGCAACGTGGAGTCGGTTTATCTCGAGATAAACCGACTCCACGTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000781.2-330s21c1
Sequence:CCGGTGGCTAAACCTGTACCATTTCCTCGAGGAAATGGTACAGGTTTAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000781.2-1029s21c1
Sequence:CCGGGGAAGTGTTCACCACGATTACCTCGAGGTAATCGTGGTGAACACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000781.2-1679s21c1
Sequence:CCGGCTTCACCTTCTGGCCCTTTAACTCGAGTTAAAGGGCCAGAAGGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000781
CYP11A1 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 11, subfamily A, polypeptide 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000781.1-887s1c1
Sequence:CCGGCCAGAACTTCTACTGGGAATTCTCGAGAATTCCCAGTAGAAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000781.1-290s1c1
Sequence:CCGGCCAGAAGTATGGCCCGATTTACTCGAGTAAATCGGGCCATACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000781.1-1364s1c1
Sequence:CCGGGCTGAGCAAAGACAAGAACATCTCGAGATGTTCTTGTCTTTGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000781.1-1500s1c1
Sequence:CCGGGAAATCCAACACCTCAGCGATCTCGAGATCGCTGAGGTGTTGGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000781.1-737s1c1
Sequence:CCGGGCGATTCATTGATGCCATCTACTCGAGTAGATGGCATCAATGAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000781.2-435s21c1
Sequence:CCGGGGCAACGTGGAGTCGGTTTATCTCGAGATAAACCGACTCCACGTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000781.2-330s21c1
Sequence:CCGGTGGCTAAACCTGTACCATTTCCTCGAGGAAATGGTACAGGTTTAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000781.2-1029s21c1
Sequence:CCGGGGAAGTGTTCACCACGATTACCTCGAGGTAATCGTGGTGAACACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000781.2-1679s21c1
Sequence:CCGGCTTCACCTTCTGGCCCTTTAACTCGAGTTAAAGGGCCAGAAGGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks