EMAIL THIS PAGE TO A FRIEND

CYP11B2

cytochrome P450, family 11, subfamily B, polypeptide 2

161 Gene Product Result for
Synonyms: ALDOS CPN2 CYP11B CYP11BL CYPXIB2 P-450C18 P450C18 P450aldo
UniProtKB ID: P19099, B0ZBE4, Q16726
Gene ID:
Human(1585) Summary: This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the mitochondrial inner membrane. The enzyme has steroid 18-hydroxylase activity to synthesize aldosterone and 18-oxocortisol as well as steroid 11 beta-hydroxylase activity. Mutations in this gene cause corticosterone methyl oxidase deficiency. [provided by RefSeq, Jul 2008]
Mouse(13072) cytochrome P450, family 11, subfamily b, polypeptide 2
Rat(24294) cytochrome P450, family 11, subfamily b, polypeptide 2
dog(482071) cytochrome P450, family 11, subfamily B, polypeptide 2
cow(282423) cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 2
Domestic Rabbit(100328543) cytochrome P450, family 11, subfamily B, polypeptide 2
domestic guinea pig(100379213) aldosterone synthase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
K1003 Ketoconazole ≥98% (HPLC) human, mouse, rat pricing
UC280 Ketoconazole human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000498 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000498 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000498 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009991 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009991 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009991 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU152861 MISSION® esiRNA esiRNA human CYP11B2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000498 Rosetta Predictions human pricing
NM_012538 Rosetta Predictions rat pricing
NM_009991 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000498 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199286 predicted 1495
2 SASI_Hs01_00199287 predicted 1497
3 SASI_Hs01_00199288 predicted 1482
4 SASI_Hs01_00199289 predicted 1829
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012538 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036773 predicted 902
2 SASI_Rn01_00036774 predicted 434
3 SASI_Rn01_00036775 predicted 416
4 SASI_Rn01_00036776 predicted 553
5 SASI_Rn01_00036777 predicted 410
6 SASI_Rn02_00259614 predicted 498
7 SASI_Rn02_00259615 predicted 568
8 SASI_Rn02_00259616 predicted 425
9 SASI_Rn01_00036778 predicted 544
10 SASI_Rn02_00259617 predicted 668
11 SASI_Rn01_00036779 predicted 867
12 SASI_Rn01_00036780 predicted 1202
13 SASI_Rn01_00036781 predicted 378
14 SASI_Rn01_00036782 predicted 782
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009991 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098630 predicted 966
2 SASI_Mm01_00098631 predicted 499
3 SASI_Mm01_00098632 predicted 1285
4 SASI_Mm01_00098633 predicted 954
5 SASI_Mm02_00317597 predicted 999
6 SASI_Mm01_00098634 predicted 526
7 SASI_Mm01_00098635 predicted 1292
8 SASI_Mm01_00098636 predicted 342
9 SASI_Mm01_00098637 predicted 946
10 SASI_Mm01_00098638 predicted 1210
11 SASI_Mm01_00098639 predicted 878
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000498
CYP11B2 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 11, subfamily B, polypeptide 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000498.2-1491s1c1
Sequence:CCGGCCTCACTTTCAGAGCGATTAACTCGAGTTAATCGCTCTGAAAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000498.2-1199s1c1
Sequence:CCGGCTGGGACATTGGTACAGGTTTCTCGAGAAACCTGTACCAATGTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000498.2-198s1c1
Sequence:CCGGCCTGGAGATGCACCAGACCTTCTCGAGAAGGTCTGGTGCATCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000498.2-801s1c1
Sequence:CCGGCGGTGACAACTGTATCCAGAACTCGAGTTCTGGATACAGTTGTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000498.2-849s1c1
Sequence:CCGGCCCTCAACACTACACAGGCATCTCGAGATGCCTGTGTAGTGTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000445357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000498.3-890s21c1
Sequence:CCGGAGGCGGAACTGTCACTAGAAGCTCGAGCTTCTAGTGACAGTTCCGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444424    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000498.3-1785s21c1
Sequence:CCGGCCTCTGGACAGCTTGACTCTACTCGAGTAGAGTCAAGCTGTCCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433176    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000498.3-1926s21c1
Sequence:CCGGCAGACAGTGTCAGAGTCATTACTCGAGTAATGACTCTGACACTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000498
CYP11B2 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 11, subfamily B, polypeptide 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000498.2-1491s1c1
Sequence:CCGGCCTCACTTTCAGAGCGATTAACTCGAGTTAATCGCTCTGAAAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000498.2-1199s1c1
Sequence:CCGGCTGGGACATTGGTACAGGTTTCTCGAGAAACCTGTACCAATGTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000498.2-198s1c1
Sequence:CCGGCCTGGAGATGCACCAGACCTTCTCGAGAAGGTCTGGTGCATCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000498.2-801s1c1
Sequence:CCGGCGGTGACAACTGTATCCAGAACTCGAGTTCTGGATACAGTTGTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000498.2-849s1c1
Sequence:CCGGCCCTCAACACTACACAGGCATCTCGAGATGCCTGTGTAGTGTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000445357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000498.3-890s21c1
Sequence:CCGGAGGCGGAACTGTCACTAGAAGCTCGAGCTTCTAGTGACAGTTCCGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444424    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000498.3-1785s21c1
Sequence:CCGGCCTCTGGACAGCTTGACTCTACTCGAGTAGAGTCAAGCTGTCCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433176    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000498.3-1926s21c1
Sequence:CCGGCAGACAGTGTCAGAGTCATTACTCGAGTAATGACTCTGACACTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000498
CYP11B2 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 11, subfamily B, polypeptide 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000498.2-1491s1c1
Sequence:CCGGCCTCACTTTCAGAGCGATTAACTCGAGTTAATCGCTCTGAAAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000498.2-1199s1c1
Sequence:CCGGCTGGGACATTGGTACAGGTTTCTCGAGAAACCTGTACCAATGTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000498.2-198s1c1
Sequence:CCGGCCTGGAGATGCACCAGACCTTCTCGAGAAGGTCTGGTGCATCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000498.2-801s1c1
Sequence:CCGGCGGTGACAACTGTATCCAGAACTCGAGTTCTGGATACAGTTGTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000498.2-849s1c1
Sequence:CCGGCCCTCAACACTACACAGGCATCTCGAGATGCCTGTGTAGTGTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000445357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000498.3-890s21c1
Sequence:CCGGAGGCGGAACTGTCACTAGAAGCTCGAGCTTCTAGTGACAGTTCCGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444424    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000498.3-1785s21c1
Sequence:CCGGCCTCTGGACAGCTTGACTCTACTCGAGTAGAGTCAAGCTGTCCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433176    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000498.3-1926s21c1
Sequence:CCGGCAGACAGTGTCAGAGTCATTACTCGAGTAATGACTCTGACACTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009991
CYP11B2 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 11, subfamily B, polypeptide 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009991.2-872s1c1
Sequence:CCGGCGGAACTAATATCTCAGGGATCTCGAGATCCCTGAGATATTAGTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009991.2-906s1c1
Sequence:CCGGCGCCATCAAAGCGAACTCTATCTCGAGATAGAGTTCGCTTTGATGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009991.2-379s1c1
Sequence:CCGGCGTGGTGTGTTCTTGCTAAATCTCGAGATTTAGCAAGAACACACCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009991.3-1528s21c1
Sequence:CCGGCAGATGGCCTACCGCTTTGTTCTCGAGAACAAAGCGGTAGGCCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009991.3-664s21c1
Sequence:CCGGAGCCTCTTCAACTACACTATACTCGAGTATAGTGTAGTTGAAGAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009991.3-1035s21c1
Sequence:CCGGGAGCGTTGACACGACAGCAATCTCGAGATTGCTGTCGTGTCAACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009991.3-352s21c1
Sequence:CCGGCAGATCGTATCTGTGATGTTGCTCGAGCAACATCACAGATACGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009991.3-843s21c1
Sequence:CCGGTCGGGTGTGGAAAGAACATTTCTCGAGAAATGTTCTTTCCACACCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009991
CYP11B2 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 11, subfamily B, polypeptide 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009991.2-872s1c1
Sequence:CCGGCGGAACTAATATCTCAGGGATCTCGAGATCCCTGAGATATTAGTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009991.2-906s1c1
Sequence:CCGGCGCCATCAAAGCGAACTCTATCTCGAGATAGAGTTCGCTTTGATGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009991.2-379s1c1
Sequence:CCGGCGTGGTGTGTTCTTGCTAAATCTCGAGATTTAGCAAGAACACACCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009991.3-1528s21c1
Sequence:CCGGCAGATGGCCTACCGCTTTGTTCTCGAGAACAAAGCGGTAGGCCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009991.3-664s21c1
Sequence:CCGGAGCCTCTTCAACTACACTATACTCGAGTATAGTGTAGTTGAAGAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009991.3-1035s21c1
Sequence:CCGGGAGCGTTGACACGACAGCAATCTCGAGATTGCTGTCGTGTCAACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009991.3-352s21c1
Sequence:CCGGCAGATCGTATCTGTGATGTTGCTCGAGCAACATCACAGATACGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009991.3-843s21c1
Sequence:CCGGTCGGGTGTGGAAAGAACATTTCTCGAGAAATGTTCTTTCCACACCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009991
CYP11B2 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 11, subfamily B, polypeptide 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009991.2-872s1c1
Sequence:CCGGCGGAACTAATATCTCAGGGATCTCGAGATCCCTGAGATATTAGTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009991.2-906s1c1
Sequence:CCGGCGCCATCAAAGCGAACTCTATCTCGAGATAGAGTTCGCTTTGATGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009991.2-379s1c1
Sequence:CCGGCGTGGTGTGTTCTTGCTAAATCTCGAGATTTAGCAAGAACACACCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009991.3-1528s21c1
Sequence:CCGGCAGATGGCCTACCGCTTTGTTCTCGAGAACAAAGCGGTAGGCCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009991.3-664s21c1
Sequence:CCGGAGCCTCTTCAACTACACTATACTCGAGTATAGTGTAGTTGAAGAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009991.3-1035s21c1
Sequence:CCGGGAGCGTTGACACGACAGCAATCTCGAGATTGCTGTCGTGTCAACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009991.3-352s21c1
Sequence:CCGGCAGATCGTATCTGTGATGTTGCTCGAGCAACATCACAGATACGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009991.3-843s21c1
Sequence:CCGGTCGGGTGTGGAAAGAACATTTCTCGAGAAATGTTCTTTCCACACCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks