EMAIL THIS PAGE TO A FRIEND

CYP17A1

cytochrome P450, family 17, subfamily A, polypeptide 1

64 Gene Product Result for
Synonyms: CPT7 CYP17 P450C17 S17AH
UniProtKB ID: P05093, Q5TZV7
Gene ID:
Human(1586) Summary: This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum. It has both 17alpha-hydroxylase and 17,20-lyase activities and is a key enzyme in the steroidogenic pathway that produces progestins, mineralocorticoids, glucocorticoids, androgens, and estrogens. Mutations in this gene are associated with isolated steroid-17 alpha-hydroxylase deficiency, 17-alpha-hydroxylase/17,20-lyase deficiency, pseudohermaphroditism, and adrenal hyperplasia. [provided by RefSeq, Jul 2008]
Mouse(13074) cytochrome P450, family 17, subfamily a, polypeptide 1
Rat(25146) cytochrome P450, family 17, subfamily a, polypeptide 1
Zebrafish(399692) cytochrome P450, family 17, subfamily A, polypeptide 1
domestic cat(493967) cytochrome P450, family 17, subfamily A, polypeptide 1
cow(281739) cytochrome P450, family 17, subfamily A, polypeptide 1
Horse(100034232) cytochrome P-450 17 alpha-hydroxylase/C17,20-lyase
dog(477807) cytochrome P450, family 17, subfamily A, polypeptide 1
chicken(425056) cytochrome P450, family 17, subfamily A, polypeptide 1
sheep(493968) cytochrome P450, family 17, subfamily A, polypeptide 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000102 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000102 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000102 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007809 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007809 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007809 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU120611 MISSION® esiRNA esiRNA human CYP17A1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000102 Rosetta Predictions human pricing
NM_012753 Rosetta Predictions rat pricing
NM_007809 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000102 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160283 predicted 362
2 SASI_Hs01_00160284 predicted 303
3 SASI_Hs01_00160285 predicted 1442
4 SASI_Hs01_00160286 predicted 1402
5 SASI_Hs01_00160287 predicted 473
6 SASI_Hs01_00160288 predicted 1186
7 SASI_Hs01_00160289 predicted 740
8 SASI_Hs01_00160290 predicted 946
9 SASI_Hs02_00301873 predicted 971
10 SASI_Hs01_00160292 predicted 689
11 SASI_Hs01_00160291 predicted 1345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012753 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094957 predicted 1298
2 SASI_Rn01_00094958 predicted 547
3 SASI_Rn01_00094959 predicted 527
4 SASI_Rn01_00094960 predicted 1249
5 SASI_Rn01_00094962 predicted 724
6 SASI_Rn01_00094963 predicted 1390
7 SASI_Rn02_00260114 predicted 827
8 SASI_Rn01_00094964 predicted 246
9 SASI_Rn02_00260115 predicted 489
10 SASI_Rn01_00094965 predicted 702
11 SASI_Rn01_00094961 predicted 573
12 SASI_Rn01_00094966 predicted 624
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007809 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081844 predicted 913
2 SASI_Mm01_00081846 predicted 1292
3 SASI_Mm01_00081847 predicted 1383
4 SASI_Mm01_00081848 predicted 1007
5 SASI_Mm01_00081849 predicted 943
6 SASI_Mm01_00081850 predicted 1000
7 SASI_Mm01_00081851 predicted 731
8 SASI_Mm02_00312525 predicted 943
9 SASI_Mm01_00081852 predicted 903
10 SASI_Mm01_00081853 predicted 608
11 SASI_Mm01_00081845 predicted 1241
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000102
CYP17A1 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 17, subfamily A, polypeptide 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000102.3-1451s21c1
Sequence:CCGGTCACCGTCAGTAAGCTATTTGCTCGAGCAAATAGCTTACTGACGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000102.3-759s21c1
Sequence:CCGGATGTCATACAGAATTACAATGCTCGAGCATTGTAATTCTGTATGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000102.3-1330s21c1
Sequence:CCGGGGACAAGGGCACAGAAGTTATCTCGAGATAACTTCTGTGCCCTTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000102.3-885s21c1
Sequence:CCGGTACGAAATGATCTGCTGAATACTCGAGTATTCAGCAGATCATTTCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000102.2-346s1c1
Sequence:CCGGCGGCCTCAAATGGCAACTCTACTCGAGTAGAGTTGCCATTTGAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000102.2-977s1c1
Sequence:CCGGCCACCACCTCTGTGGTTAAATCTCGAGATTTAACCACAGAGGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000102.2-201s1c1
Sequence:CCGGCCATATGCATAACAACTTCTTCTCGAGAAGAAGTTGTTATGCATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000102.2-1515s1c1
Sequence:CCGGGATCGACTCTTTCAAAGTGAACTCGAGTTCACTTTGAAAGAGTCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000102.2-547s1c1
Sequence:CCGGCAGTCCATAGACATCTCCTTTCTCGAGAAAGGAGATGTCTATGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000102
CYP17A1 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 17, subfamily A, polypeptide 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000102.3-1451s21c1
Sequence:CCGGTCACCGTCAGTAAGCTATTTGCTCGAGCAAATAGCTTACTGACGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000102.3-759s21c1
Sequence:CCGGATGTCATACAGAATTACAATGCTCGAGCATTGTAATTCTGTATGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000102.3-1330s21c1
Sequence:CCGGGGACAAGGGCACAGAAGTTATCTCGAGATAACTTCTGTGCCCTTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000102.3-885s21c1
Sequence:CCGGTACGAAATGATCTGCTGAATACTCGAGTATTCAGCAGATCATTTCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000102.2-346s1c1
Sequence:CCGGCGGCCTCAAATGGCAACTCTACTCGAGTAGAGTTGCCATTTGAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000102.2-977s1c1
Sequence:CCGGCCACCACCTCTGTGGTTAAATCTCGAGATTTAACCACAGAGGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000102.2-201s1c1
Sequence:CCGGCCATATGCATAACAACTTCTTCTCGAGAAGAAGTTGTTATGCATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000102.2-1515s1c1
Sequence:CCGGGATCGACTCTTTCAAAGTGAACTCGAGTTCACTTTGAAAGAGTCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000102.2-547s1c1
Sequence:CCGGCAGTCCATAGACATCTCCTTTCTCGAGAAAGGAGATGTCTATGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000102
CYP17A1 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 17, subfamily A, polypeptide 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000102.3-1451s21c1
Sequence:CCGGTCACCGTCAGTAAGCTATTTGCTCGAGCAAATAGCTTACTGACGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000102.3-759s21c1
Sequence:CCGGATGTCATACAGAATTACAATGCTCGAGCATTGTAATTCTGTATGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000102.3-1330s21c1
Sequence:CCGGGGACAAGGGCACAGAAGTTATCTCGAGATAACTTCTGTGCCCTTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000102.3-885s21c1
Sequence:CCGGTACGAAATGATCTGCTGAATACTCGAGTATTCAGCAGATCATTTCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000102.2-346s1c1
Sequence:CCGGCGGCCTCAAATGGCAACTCTACTCGAGTAGAGTTGCCATTTGAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000102.2-977s1c1
Sequence:CCGGCCACCACCTCTGTGGTTAAATCTCGAGATTTAACCACAGAGGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000102.2-201s1c1
Sequence:CCGGCCATATGCATAACAACTTCTTCTCGAGAAGAAGTTGTTATGCATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000102.2-1515s1c1
Sequence:CCGGGATCGACTCTTTCAAAGTGAACTCGAGTTCACTTTGAAAGAGTCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000102.2-547s1c1
Sequence:CCGGCAGTCCATAGACATCTCCTTTCTCGAGAAAGGAGATGTCTATGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007809
CYP17A1 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 17, subfamily A, polypeptide 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126104    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007809.2-1658s1c1
Sequence:CCGGGCCGAATCTAACGTCCCGGATCTCGAGATCCGGGACGTTAGATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007809.2-183s1c1
Sequence:CCGGCCCAAGTCAAAGACACCTAATCTCGAGATTAGGTGTCTTTGACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007809.2-1251s1c1
Sequence:CCGGGCTAACATTGACTCCAGCATTCTCGAGAATGCTGGAGTCAATGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007809.2-635s1c1
Sequence:CCGGGCTCATCTTCAAGTCAGTAATCTCGAGATTACTGACTTGAAGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007809.2-348s1c1
Sequence:CCGGGCAGTGATTGTCGGTCACTATCTCGAGATAGTGACCGACAATCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007809
CYP17A1 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 17, subfamily A, polypeptide 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126104    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007809.2-1658s1c1
Sequence:CCGGGCCGAATCTAACGTCCCGGATCTCGAGATCCGGGACGTTAGATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007809.2-183s1c1
Sequence:CCGGCCCAAGTCAAAGACACCTAATCTCGAGATTAGGTGTCTTTGACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007809.2-1251s1c1
Sequence:CCGGGCTAACATTGACTCCAGCATTCTCGAGAATGCTGGAGTCAATGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007809.2-635s1c1
Sequence:CCGGGCTCATCTTCAAGTCAGTAATCTCGAGATTACTGACTTGAAGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007809.2-348s1c1
Sequence:CCGGGCAGTGATTGTCGGTCACTATCTCGAGATAGTGACCGACAATCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007809
CYP17A1 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 17, subfamily A, polypeptide 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126104    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007809.2-1658s1c1
Sequence:CCGGGCCGAATCTAACGTCCCGGATCTCGAGATCCGGGACGTTAGATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007809.2-183s1c1
Sequence:CCGGCCCAAGTCAAAGACACCTAATCTCGAGATTAGGTGTCTTTGACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007809.2-1251s1c1
Sequence:CCGGGCTAACATTGACTCCAGCATTCTCGAGAATGCTGGAGTCAATGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007809.2-635s1c1
Sequence:CCGGGCTCATCTTCAAGTCAGTAATCTCGAGATTACTGACTTGAAGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007809.2-348s1c1
Sequence:CCGGGCAGTGATTGTCGGTCACTATCTCGAGATAGTGACCGACAATCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks