EMAIL THIS PAGE TO A FRIEND

CYP19A1

cytochrome P450, family 19, subfamily A, polypeptide 1

159 Gene Product Result for
Synonyms: ARO ARO1 CPV1 CYAR CYP19 CYPXIX P-450AROM
UniProtKB ID: P11511, Q16731, Q3B764, Q58FA0
Gene ID:
Human(1588) Summary: This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and catalyzes the last steps of estrogen biosynthesis, three successive hydroxylations of the A ring of androgens. Mutations in this gene can result in either increased or decreased aromatase activity; the associated phenotypes suggest that estrogen functions both as a sex steroid hormone and in growth or differentiation. The gene expresses two transcript variants. [provided by RefSeq, Jul 2008]
Mouse(13075) cytochrome P450, family 19, subfamily a, polypeptide 1
Rat(25147) cytochrome P450, family 19, subfamily a, polypeptide 1
Goat(100861413) cytochrome P450, family 19, subfamily A, polypeptide 1
Domestic Rabbit(100328545) cytochrome P450, family 19, subfamily A, polypeptide 1
chicken(414854) cytochrome P450, family 19, subfamily A, polypeptide 1
Horse(100009712) cytochrome P450, family 19, subfamily A, polypeptide 1
dog(494003) cytochrome P450, family 17, subfamily A, polypeptide 1
cow(281740) cytochrome P450, family 19, subfamily A, polypeptide 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Cell Lines

Product # Description Species Add to Cart
 
MTOXCE19A1 CypExpress Aromatase human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000103 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000103 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000103 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007810 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007810 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007810 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000103 Rosetta Predictions human pricing
NM_031226 Rosetta Predictions human pricing
NM_017085 Rosetta Predictions rat pricing
NM_007810 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000103 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201877 predicted 433
2 SASI_Hs01_00201878 predicted 842
3 SASI_Hs01_00201879 predicted 878
4 SASI_Hs01_00201880 predicted 1678
5 SASI_Hs02_00301874 predicted 1723
6 SASI_Hs01_00201881 predicted 816
7 SASI_Hs02_00301875 predicted 763
8 SASI_Hs01_00201882 predicted 960
9 SASI_Hs01_00201883 predicted 1162
10 SASI_Hs01_00201884 predicted 1108
11 SASI_Hs01_00201885 predicted 530
12 SASI_Hs01_00201886 predicted 522
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031226 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181962 predicted 550
2 SASI_Hs01_00181963 predicted 947
3 SASI_Hs01_00181964 predicted 996
4 SASI_Hs01_00181965 predicted 1787
5 SASI_Hs02_00358637 predicted 1837
6 SASI_Hs01_00181966 predicted 924
7 SASI_Hs02_00358638 predicted 876
8 SASI_Hs01_00181967 predicted 1065
9 SASI_Hs01_00181968 predicted 1268
10 SASI_Hs01_00181969 predicted 1224
11 SASI_Hs01_00181970 predicted 637
12 SASI_Hs01_00181971 predicted 624
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017085 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062400 predicted 336
2 SASI_Rn01_00062401 predicted 1088
3 SASI_Rn01_00062402 predicted 943
4 SASI_Rn01_00062403 predicted 1289
5 SASI_Rn01_00062404 predicted 1253
6 SASI_Rn01_00062405 predicted 383
7 SASI_Rn01_00062406 predicted 438
8 SASI_Rn01_00062407 predicted 809
9 SASI_Rn01_00062408 predicted 997
10 SASI_Rn01_00062409 predicted 931
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007810 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082955 predicted 1527
2 SASI_Mm01_00082956 predicted 1043
3 SASI_Mm01_00082957 predicted 1068
4 SASI_Mm01_00082958 predicted 1262
5 SASI_Mm02_00312526 predicted 337
6 SASI_Mm01_00082959 predicted 975
7 SASI_Mm01_00082960 predicted 617
8 SASI_Mm01_00082961 predicted 363
9 SASI_Mm01_00082962 predicted 1238
10 SASI_Mm01_00082963 predicted 908
11 SASI_Mm01_00082964 predicted 1217
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000103
CYP19A1 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 19, subfamily A, polypeptide 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000103.2-1117s1c1
Sequence:CCGGCCTAATGTTGAAGAGGCAATACTCGAGTATTGCCTCTTCAACATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000103.2-468s1c1
Sequence:CCGGCAATCATTACAGCTCTCGATTCTCGAGAATCGAGAGCTGTAATGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000103.2-768s1c1
Sequence:CCGGCGAAAGTGCTATCGTGGTTAACTCGAGTTAACCACGATAGCACTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000103.2-362s1c1
Sequence:CCGGGCAACTACTACAACCGGGTATCTCGAGATACCCGGTTGTAGTAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000103.2-1494s1c1
Sequence:CCGGCGTTACACTTCTGAGACGATTCTCGAGAATCGTCTCAGAAGTGTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000103
CYP19A1 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 19, subfamily A, polypeptide 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000103.2-1117s1c1
Sequence:CCGGCCTAATGTTGAAGAGGCAATACTCGAGTATTGCCTCTTCAACATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000103.2-468s1c1
Sequence:CCGGCAATCATTACAGCTCTCGATTCTCGAGAATCGAGAGCTGTAATGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000103.2-768s1c1
Sequence:CCGGCGAAAGTGCTATCGTGGTTAACTCGAGTTAACCACGATAGCACTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000103.2-362s1c1
Sequence:CCGGGCAACTACTACAACCGGGTATCTCGAGATACCCGGTTGTAGTAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000103.2-1494s1c1
Sequence:CCGGCGTTACACTTCTGAGACGATTCTCGAGAATCGTCTCAGAAGTGTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000103
CYP19A1 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 19, subfamily A, polypeptide 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000103.2-1117s1c1
Sequence:CCGGCCTAATGTTGAAGAGGCAATACTCGAGTATTGCCTCTTCAACATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000103.2-468s1c1
Sequence:CCGGCAATCATTACAGCTCTCGATTCTCGAGAATCGAGAGCTGTAATGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000103.2-768s1c1
Sequence:CCGGCGAAAGTGCTATCGTGGTTAACTCGAGTTAACCACGATAGCACTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000103.2-362s1c1
Sequence:CCGGGCAACTACTACAACCGGGTATCTCGAGATACCCGGTTGTAGTAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000103.2-1494s1c1
Sequence:CCGGCGTTACACTTCTGAGACGATTCTCGAGAATCGTCTCAGAAGTGTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007810
CYP19A1 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 19, subfamily A, polypeptide 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257939    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007810.3-1932s21c1
Sequence:CCGGGCATGTGGGCCAGGCATAAATCTCGAGATTTATGCCTGGCCCACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007810.3-913s21c1
Sequence:CCGGTGACGAAAGAGAACGTGAATCCTCGAGGATTCACGTTCTCTTTCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007810.3-1171s21c1
Sequence:CCGGCTCTGGAGGATGACGTAATTGCTCGAGCAATTACGTCATCCTCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007810.3-787s21c1
Sequence:CCGGAGGACTTGAAAGACGAGATAGCTCGAGCTATCTCGTCTTTCAAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007810.3-423s21c1
Sequence:CCGGCATGAGAACGGCATCATATTTCTCGAGAAATATGATGCCGTTCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007810
CYP19A1 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 19, subfamily A, polypeptide 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257939    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007810.3-1932s21c1
Sequence:CCGGGCATGTGGGCCAGGCATAAATCTCGAGATTTATGCCTGGCCCACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007810.3-913s21c1
Sequence:CCGGTGACGAAAGAGAACGTGAATCCTCGAGGATTCACGTTCTCTTTCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007810.3-1171s21c1
Sequence:CCGGCTCTGGAGGATGACGTAATTGCTCGAGCAATTACGTCATCCTCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007810.3-787s21c1
Sequence:CCGGAGGACTTGAAAGACGAGATAGCTCGAGCTATCTCGTCTTTCAAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007810.3-423s21c1
Sequence:CCGGCATGAGAACGGCATCATATTTCTCGAGAAATATGATGCCGTTCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007810
CYP19A1 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 19, subfamily A, polypeptide 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257939    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007810.3-1932s21c1
Sequence:CCGGGCATGTGGGCCAGGCATAAATCTCGAGATTTATGCCTGGCCCACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007810.3-913s21c1
Sequence:CCGGTGACGAAAGAGAACGTGAATCCTCGAGGATTCACGTTCTCTTTCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007810.3-1171s21c1
Sequence:CCGGCTCTGGAGGATGACGTAATTGCTCGAGCAATTACGTCATCCTCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007810.3-787s21c1
Sequence:CCGGAGGACTTGAAAGACGAGATAGCTCGAGCTATCTCGTCTTTCAAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007810.3-423s21c1
Sequence:CCGGCATGAGAACGGCATCATATTTCTCGAGAAATATGATGCCGTTCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks