EMAIL THIS PAGE TO A FRIEND

CYP1A1

cytochrome P450, family 1, subfamily A, polypeptide 1

62 Gene Product Result for
Synonyms: AHH AHRR CP11 CYP1 P1-450 P450-C P450DX
UniProtKB ID: P04798, Q53G18
Gene ID:
Human(1543) Summary: This gene, CYP1A1, encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and its expression is induced by some polycyclic aromatic hydrocarbons (PAHs), some of which are found in cigarette smoke. The enzyme's endogenous substrate is unknown; however, it is able to metabolize some PAHs to carcinogenic intermediates. The gene has been associated with lung cancer risk. A related family member, CYP1A2, is located approximately 25 kb away from CYP1A1 on chromosome 15. [provided by RefSeq, Jul 2008]
Mouse(13076) cytochrome P450, family 1, subfamily a, polypeptide 1
Rat(24296) cytochrome P450, family 1, subfamily a, polypeptide 1
chicken(396051) cytochrome P450, family 1, subfamily A, polypeptide 1
domestic cat(554347) cytochrome P450 1A1
cow(282870) cytochrome P450, subfamily I (aromatic compound-inducible), polypeptide 1
Horse(100062285) cytochrome P450, family 1, subfamily A, polypeptide 1
dog(100686778) cytochrome P450, family 1, subfamily A, polypeptide 1
dog(487648) cytochrome P450
domestic guinea pig(100135512) cytochrome P450, family 1, subfamily a, polypeptide 1
sheep(100170113) cytochrome P4501A1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108544 Anti-CYP1A1 (AB2) affinity isolated antibody human, sheep, rat, guinea pig, human, zebrafish, canine, mouse, bovine, rabbit
immunohistochemistry, western blot pricing
AV41404 Anti-CYP1A1 (AB2) antibody produced in rabbit affinity isolated antibody pig, horse, rabbit, guinea pig, rabbit, mouse, sheep, human, rat
western blot pricing
SAB2108545 Anti-CYP1A1 (AB3) affinity isolated antibody human, rabbit, sheep, pig, guinea pig, zebrafish, horse, rat, bovine, horse, goat
western blot pricing
AV41405 Anti-CYP1A1 (AB3) antibody produced in rabbit affinity isolated antibody goat, guinea pig, horse, rabbit, sheep, human, mouse, rat
western blot pricing
SAB2501753 Anti-cyp1a1 antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, rat
ELISA, western blot pricing
SAB1408926 Anti-CYP1A1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1410273 Anti-CYP1A1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB4500579 Anti-Cytochrome P450 1A1 antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB5300119 Monoclonal Anti-CYP1A1 antibody produced in mouse clone 6G5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
R3277 Rutaecarpine >98% (HPLC) human pricing

Cell Lines

Product # Description Species Add to Cart
 
MTOXCE1A1 CypExpress 1A1 Cytochrome P450 human human pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0031 AQUA Peptide YGDVLQI[R] cow, dog, human, mouse, pig, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000499 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000499 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000499 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009992 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009992 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009992 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU058161 MISSION® esiRNA esiRNA human CYP1A1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000499 Rosetta Predictions human pricing
NM_012540 Rosetta Predictions rat pricing
NM_009992 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000499 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067924 predicted 1296
2 SASI_Hs01_00067925 predicted 1740
3 SASI_Hs01_00067927 predicted 1723
4 SASI_Hs01_00067928 predicted 750
5 SASI_Hs02_00302665 predicted 1387
6 SASI_Hs01_00067929 predicted 1687
7 SASI_Hs01_00067930 predicted 1733
8 SASI_Hs01_00067931 predicted 1431
9 SASI_Hs01_00067933 predicted 1335
10 SASI_Hs02_00302666 predicted 1737
11 SASI_Hs01_00067926 predicted 1404
12 SASI_Hs01_00067932 predicted 867
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012540 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049796 predicted 1263
2 SASI_Rn01_00049797 predicted 678
3 SASI_Rn01_00049798 predicted 413
4 SASI_Rn02_00259618 predicted 754
5 SASI_Rn01_00049799 predicted 1250
6 SASI_Rn01_00049800 predicted 573
7 SASI_Rn01_00049801 predicted 888
8 SASI_Rn01_00049802 predicted 1546
9 SASI_Rn01_00049803 predicted 1347
10 SASI_Rn01_00049804 predicted 422
11 SASI_Rn01_00049805 predicted 743
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009992 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150321 predicted 831
2 SASI_Mm01_00150322 predicted 938
3 SASI_Mm01_00150323 predicted 241
4 SASI_Mm01_00150324 predicted 769
5 SASI_Mm01_00150325 predicted 1649
6 SASI_Mm01_00150326 predicted 865
7 SASI_Mm01_00150327 predicted 1462
8 SASI_Mm01_00150328 predicted 786
9 SASI_Mm01_00150329 predicted 988
10 SASI_Mm02_00317598 predicted 967
11 SASI_Mm01_00150320 predicted 1603
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000499
CYP1A1 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 1, subfamily A, polypeptide 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000499.3-1641s21c1
Sequence:CCGGCAAATGCAGCTGCGCTCTTAGCTCGAGCTAAGAGCGCAGCTGCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000499.3-1048s21c1
Sequence:CCGGACATCGTCTTGGACCTCTTTGCTCGAGCAAAGAGGTCCAAGACGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000499.2-822s1c1
Sequence:CCGGGCTGACTTCATCCCTATTCTTCTCGAGAAGAATAGGGATGAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000499.2-1288s1c1
Sequence:CCGGGCACAACAAGAGACACAAGTTCTCGAGAACTTGTGTCTCTTGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000499.2-179s1c1
Sequence:CCGGCTGTCTGGTATTCTGGGTAATCTCGAGATTACCCAGAATACCAGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000499.2-769s1c1
Sequence:CCGGGCCTAGTCAACCTGAATAATACTCGAGTATTATTCAGGTTGACTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000499
CYP1A1 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 1, subfamily A, polypeptide 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000499.3-1641s21c1
Sequence:CCGGCAAATGCAGCTGCGCTCTTAGCTCGAGCTAAGAGCGCAGCTGCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000499.3-1048s21c1
Sequence:CCGGACATCGTCTTGGACCTCTTTGCTCGAGCAAAGAGGTCCAAGACGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000499.2-822s1c1
Sequence:CCGGGCTGACTTCATCCCTATTCTTCTCGAGAAGAATAGGGATGAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000499.2-1288s1c1
Sequence:CCGGGCACAACAAGAGACACAAGTTCTCGAGAACTTGTGTCTCTTGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000499.2-179s1c1
Sequence:CCGGCTGTCTGGTATTCTGGGTAATCTCGAGATTACCCAGAATACCAGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000499.2-769s1c1
Sequence:CCGGGCCTAGTCAACCTGAATAATACTCGAGTATTATTCAGGTTGACTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000499
CYP1A1 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 1, subfamily A, polypeptide 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000499.3-1641s21c1
Sequence:CCGGCAAATGCAGCTGCGCTCTTAGCTCGAGCTAAGAGCGCAGCTGCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000499.3-1048s21c1
Sequence:CCGGACATCGTCTTGGACCTCTTTGCTCGAGCAAAGAGGTCCAAGACGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000499.2-822s1c1
Sequence:CCGGGCTGACTTCATCCCTATTCTTCTCGAGAAGAATAGGGATGAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000499.2-1288s1c1
Sequence:CCGGGCACAACAAGAGACACAAGTTCTCGAGAACTTGTGTCTCTTGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000499.2-179s1c1
Sequence:CCGGCTGTCTGGTATTCTGGGTAATCTCGAGATTACCCAGAATACCAGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000499.2-769s1c1
Sequence:CCGGGCCTAGTCAACCTGAATAATACTCGAGTATTATTCAGGTTGACTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009992
VALIDATED
CYP1A1 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 1, subfamily A, polypeptide 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257845    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009992.3-1787s21c1
Sequence:CCGGTGTTCCTGTGATTCAACTTTACTCGAGTAAAGTTGAATCACAGGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009992.3-741s21c1
Sequence:CCGGCTTTGACCCTTACAAGTATTTCTCGAGAAATACTTGTAAGGGTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009992.3-1417s21c1
Sequence:CCGGGTGAACCAGTGGCAGGTTAACCTCGAGGTTAACCTGCCACTGGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009992.3-741s1c1
Sequence:CCGGCTTTGACCCTTACAAGTATTTCTCGAGAAATACTTGTAAGGGTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009992.3-793s21c1
Sequence:CCGGATATGCTTTGGCCAACGTTATCTCGAGATAACGTTGGCCAAAGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009992.3-1668s21c1
Sequence:CCGGTACCTATGGGCTGACTTTAAACTCGAGTTTAAAGTCAGCCCATAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175554    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009992.2-1917s1c1
Sequence:CCGGCCTTCTCAATTTCAGCATCAACTCGAGTTGATGCTGAAATTGAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174946    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009992.2-982s1c1
Sequence:CCGGGAAGTTAATCAAAGAGCACTACTCGAGTAGTGCTCTTTGATTAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193564    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009992.2-2543s1c1
Sequence:CCGGGCTTTGTATTATGGACTGTATCTCGAGATACAGTCCATAATACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009992
VALIDATED
CYP1A1 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 1, subfamily A, polypeptide 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257845    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009992.3-1787s21c1
Sequence:CCGGTGTTCCTGTGATTCAACTTTACTCGAGTAAAGTTGAATCACAGGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009992.3-741s21c1
Sequence:CCGGCTTTGACCCTTACAAGTATTTCTCGAGAAATACTTGTAAGGGTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009992.3-1417s21c1
Sequence:CCGGGTGAACCAGTGGCAGGTTAACCTCGAGGTTAACCTGCCACTGGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009992.3-741s1c1
Sequence:CCGGCTTTGACCCTTACAAGTATTTCTCGAGAAATACTTGTAAGGGTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009992.3-793s21c1
Sequence:CCGGATATGCTTTGGCCAACGTTATCTCGAGATAACGTTGGCCAAAGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009992.3-1668s21c1
Sequence:CCGGTACCTATGGGCTGACTTTAAACTCGAGTTTAAAGTCAGCCCATAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175554    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009992.2-1917s1c1
Sequence:CCGGCCTTCTCAATTTCAGCATCAACTCGAGTTGATGCTGAAATTGAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174946    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009992.2-982s1c1
Sequence:CCGGGAAGTTAATCAAAGAGCACTACTCGAGTAGTGCTCTTTGATTAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193564    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009992.2-2543s1c1
Sequence:CCGGGCTTTGTATTATGGACTGTATCTCGAGATACAGTCCATAATACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009992
VALIDATED
CYP1A1 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 1, subfamily A, polypeptide 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257845    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009992.3-1787s21c1
Sequence:CCGGTGTTCCTGTGATTCAACTTTACTCGAGTAAAGTTGAATCACAGGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009992.3-741s21c1
Sequence:CCGGCTTTGACCCTTACAAGTATTTCTCGAGAAATACTTGTAAGGGTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009992.3-1417s21c1
Sequence:CCGGGTGAACCAGTGGCAGGTTAACCTCGAGGTTAACCTGCCACTGGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009992.3-741s1c1
Sequence:CCGGCTTTGACCCTTACAAGTATTTCTCGAGAAATACTTGTAAGGGTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009992.3-793s21c1
Sequence:CCGGATATGCTTTGGCCAACGTTATCTCGAGATAACGTTGGCCAAAGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009992.3-1668s21c1
Sequence:CCGGTACCTATGGGCTGACTTTAAACTCGAGTTTAAAGTCAGCCCATAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175554    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009992.2-1917s1c1
Sequence:CCGGCCTTCTCAATTTCAGCATCAACTCGAGTTGATGCTGAAATTGAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174946    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009992.2-982s1c1
Sequence:CCGGGAAGTTAATCAAAGAGCACTACTCGAGTAGTGCTCTTTGATTAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193564    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009992.2-2543s1c1
Sequence:CCGGGCTTTGTATTATGGACTGTATCTCGAGATACAGTCCATAATACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks