EMAIL THIS PAGE TO A FRIEND

CYP1A2

cytochrome P450, family 1, subfamily A, polypeptide 2

266 Gene Product Result for
Synonyms: CP12 P3-450 P450(PA)
UniProtKB ID: P05177, Q16754, Q6NWU5, Q9BXX7, Q9UK49
Gene ID:
Human(1544) Summary: This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. The protein encoded by this gene localizes to the endoplasmic reticulum and its expression is induced by some polycyclic aromatic hydrocarbons (PAHs), some of which are found in cigarette smoke. The enzyme's endogenous substrate is unknown; however, it is able to metabolize some PAHs to carcinogenic intermediates. Other xenobiotic substrates for this enzyme include caffeine, aflatoxin B1, and acetaminophen. The transcript from this gene contains four Alu sequences flanked by direct repeats in the 3' untranslated region. [provided by RefSeq, Jul 2008]
Mouse(13077) cytochrome P450, family 1, subfamily a, polypeptide 2
Rat(24297) cytochrome P450, family 1, subfamily a, polypeptide 2
domestic guinea pig(100135513) cytochrome P450, family 1, subfamily a, polypeptide 2
chicken(414856) cytochrome P450, family 1, subfamily A, polypeptide 2
domestic cat(554345) cytochrome P450 1A2
dog(494010) cytochrome P450, family 1, subfamily A, polypeptide 2
cow(503552) cytochrome P450, family 1, subfamily A, polypeptide 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
P4670 Propafenone hydrochloride human pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
N5893 (±)-Naringenin ≥95% human pricing
71155 (±)-Naringenin ~95% (HPCE) human pricing
E1753 (−)-Epicatechin ≥90% (HPLC) human pricing
E4018 (−)-Epicatechin ≥98% (HPLC), from green tea human pricing
E3893 (−)-Epicatechin gallate ≥98% (HPLC), from green tea human pricing
08108 (−)-Epigallocatechin analytical standard human pricing
E3768 (−)-Epigallocatechin ≥95% (HPLC), from green tea human pricing
50299 (−)-Epigallocatechin gallate ≥97.0% (HPLC) human pricing
E4143 (−)-Epigallocatechin gallate ≥95% human pricing
E4268 (−)-Epigallocatechin gallate ≥80% (HPLC), from green tea human pricing
62118 (R)-(+)-Limonene analytical standard human pricing
183164 (R)-(+)-Limonene 97% human pricing
W263303 (R)-(+)-Limonene ≥93% human pricing
36943 1,2-Dimethylnaphthalene analytical standard human pricing
360740 1,2-Dimethylnaphthalene 95% human pricing
D170208 1,3-Dimethylnaphthalene 96% human pricing
37883 1,4-Dimethylnaphthalene analytical standard human pricing
D170305 1,4-Dimethylnaphthalene 95% human pricing
45785 1,6-Dimethylnaphthalene analytical standard human pricing
250937 1,6-Dimethylnaphthalene 99% human pricing
A3940 1-Aminobenzotriazole Green Alternative human pricing
07035 1-Aminobenzotriazole ≥98.0% (GC) human pricing
185752 1-Chloronaphthalene technical grade human pricing
25320 1-Chloronaphthalene technical, ≥85% (GC) human pricing
W319309 1-Methylnaphthalene ≥95% human pricing
M56808 1-Methylnaphthalene 95% human pricing
45795 1-Methylnaphthalene analytical standard human pricing
442430 1-Methylnaphthalene analytical standard human pricing
N1000 1-Naphthol ReagentPlus®, ≥99% human pricing
31097 1-Naphthol PESTANAL®, analytical standard human pricing
N2780 1-Naphthol BioXtra, ≥99% human pricing
33420 1-Naphthol puriss. p.a., Reag. Ph. Eur., ≥99% (GC) human pricing
70442 1-Naphthol ≥98.0% (GC) human pricing
37281 2,3-Dihydrobenzofuran purum, ≥97.0% (GC) human pricing
183962 2,3-Dihydrobenzofuran 99% human pricing
126535 2,6-Dimethylnaphthalene 99% human pricing
144029 2,6-Dimethylquinoline 98% human pricing
279919 2,7-Dimethylnaphthalene 99% human pricing
145645 2,7-Dimethylquinoline 99% human pricing
132020 2-(p-Tolyl)ethylamine 97% human pricing
157058 2-Benzoxazolinone 98% human pricing
124591 2-Coumaranone 97% human pricing
E40005 2-Ethylnaphthalene ≥99% human pricing
146692 2-Indanone 98% human pricing
301507 2-Mercapto-1-methylimidazole ≥99% human pricing
148245 2-Methoxynaphthalene 99% human pricing
45796 2-Methylnaphthalene analytical standard human pricing
442359 2-Methylnaphthalene analytical standard human pricing
70448 2-Naphthol BioXtra, ≥99.0% (GC) human pricing
70450 2-Naphthol fluorescence indicator, ≥99.0% human pricing
185507 2-Naphthol 99% human pricing
130109 2-Naphthol 98% human pricing
W401404 2-Phenylethyl isothiocyanate FG human pricing
129895 3-Methylisoquinoline 98% human pricing
382493 3-Methylquinoline 99% human pricing
370207 4,6-Dimethyl-α-pyrone 98% human pricing
360872 4-Methoxy-2(5H)-furanone 99% human pricing
298069 5-Decanolide ≥98% human pricing
SRA1 Anisaldehyde solution human pricing
31581 Anthracene analytical standard human pricing
48567 Anthracene analytical standard human pricing
10580 Anthracene suitable for scintillation, ≥99.0% (GC) human pricing
331481 Anthracene zone-refined, ≥99% human pricing
141062 Anthracene ReagentPlus®, 99% human pricing
A89200 Anthracene reagent grade, 97% human pricing
40076 Anthracene solution certified reference material, 1000 μg/mL in acetone human pricing
48647 Anthracene solution certified reference material, 200 μg/mL in methanol human pricing
B0385 Beclomethasone ≥99% human pricing
B2209 Benz[a]anthracene 99% human pricing
48563 Benz[a]anthracene analytical standard human pricing
BCR271 Benz[a]anthracene BCR® certified Reference Material human pricing
36956 Benz[a]anthracene solution 100 ng/μL in cyclohexane, analytical standard human pricing
48651 Benz[a]anthracene solution certified reference material, 200 μg/mL in methylene chloride human pricing
40070-U Benz[a]anthracene solution certified reference material, 1000 μg/mL in methanol human pricing
D79403 Bicyclohexyl 99% human pricing
35800 Biphenyl PESTANAL®, analytical standard human pricing
B34656 Biphenyl ReagentPlus®, 99.5% human pricing
W312908 Biphenyl ≥99% human pricing
442487 Biphenyl analytical standard human pricing
B2635 Busulfan analytical standard, for drug analysis human pricing
19600 Butylbenzene analytical standard human pricing
B90203 Butylbenzene ≥99% human pricing
47322 Butylbenzene analytical standard human pricing
110388 Butylcyclohexane ≥99% human pricing
C9377 Chenodeoxycholic acid ≥97% human pricing
C0378 Chloramphenicol ≥98% (HPLC) human pricing
C7795 Chloramphenicol γ-irradiated human pricing
C1919 Chloramphenicol BioReagent, suitable for plant cell culture human pricing
C0857 Chloramphenicol meets USP testing specifications human pricing
31667 Chloramphenicol VETRANAL, analytical standard human pricing
23276 Chloramphenicol tested according to Ph.Eur. human pricing
C1863 Chloramphenicol Biotechnology Performance Certified, suitable for plant cell culture human pricing
C1129 Cholic acid from ox or sheep bile, ≥98% human pricing
W230316 Citral natural, ≥96%, FCC, FG human pricing
C83007 Citral 95% human pricing
W230308 Citral mixture of cis and trans, ≥96%, FG human pricing
C7727 Curcumin ≥94% (curcuminoid content), ≥80% (Curcumin) human pricing
C1386 Curcumin from Curcuma longa (Turmeric), powder human pricing
W236128 δ-Decalactone natural, ≥98%, FCC, FG human pricing
W236101 δ-Decalactone ≥98%, FCC, FG human pricing
E3764 Enoxacin analytical standard human pricing
F8929 Fluconazole ≥98% (HPLC), powder human pricing
F124 Furafylline ≥98% (HPLC) human pricing
F4381 Furosemide human pricing
303836 γ-Caprolactone 98% human pricing
W236004 γ-Decalactone ≥98%, FG, FCC human pricing
D804 γ-Decanolactone 98% human pricing
W240001 γ-Dodecalactone ≥97%, FCC, FG human pricing
W253901 γ-Heptalactone ≥98%, FCC, FG human pricing
W255602 γ-Hexalactone ≥98%, FCC, FG human pricing
292370 γ-Nonanoic lactone 97% human pricing
W278106 γ-Nonanoic lactone ≥98%, FCC, FG human pricing
176451 γ-Phenyl-γ-butyrolactone 99% human pricing
W309109 γ-Undecalactone ≥98%, FCC, FG human pricing
V403 γ-Valerolactone ReagentPlus®, 99% human pricing
W310301 γ-Valerolactone ≥99%, FCC, FG human pricing
G7012 Guaiacol glyceryl ether carbamate analytical standard human pricing
H4125 Hesperetin analytical standard human pricing
H8627 Hydroxyurea 98%, powder human pricing
45789 Indan analytical standard human pricing
I1804 Indan 95% human pricing
46429 Methimazole VETRANAL, analytical standard human pricing
M8506 Methimazole analytical standard human pricing
M9140 Methylene blue certified by the Biological Stain Commission human pricing
69870 Morin hydrate for microscopy (Fl.), for the determination of Al, Be, Zn, Ga, In, Sc, 1-2 mol/mol water human pricing
N1892 Nadolol analytical standard human pricing
84679 Naphthalene analytical standard human pricing
184500 Naphthalene suitable for scintillation, ≥99% human pricing
147141 Naphthalene 99% human pricing
48546 Naphthalene analytical standard human pricing
T66001 Naringenin human pricing
W525308 Nerolin Yara Yara ≥99% human pricing
O104 Omeprazole solid human pricing
97063 p-Anisaldehyde analytical standard human pricing
A88107 p-Anisaldehyde 98% human pricing
W267007 p-Anisaldehyde ≥97.5%, FCC, FG human pricing
35586 PCB No 1 analytical standard human pricing
35596 PCB No 3 analytical standard human pricing
260878 Phenanthrene zone-refined, ≥99.5% human pricing
P11409 Phenanthrene 98% human pricing
77470 Phenanthrene purum, for fluorescence, ≥97.0% (HPLC) human pricing
48569 Phenanthrene analytical standard, for environmental analysis human pricing
253731 Phenethyl isothiocyanate 99% human pricing
P7903 Pipemidic acid human pricing
82648 Pyrene puriss. p.a., for fluorescence, ≥99.0% (GC) human pricing
571245 Pyrene sublimed grade, 99% human pricing
185515 Pyrene 98% human pricing
131598 Pyrene crystalline, 95% human pricing
BCR177R Pyrene BCR® certified Reference Material human pricing
40082 Pyrene certified reference material, 1000 μg/mL in methanol human pricing
48570 Pyrene analytical standard human pricing
P5669 Pyridoxine ≥98% human pricing
Q2125 Quinaldine analytical standard, ≥90% (GC) human pricing
22550 Quinaldine ≥95.0% (GC) human pricing
R3277 Rutaecarpine >98% (HPLC) human pricing
S8307 SB 203580 solid, ≥98% (HPLC) human pricing
T3258 Tetracycline ≥88.0% (HPLC) human pricing
87128 Tetracycline ≥98.0% (NT) human pricing
86720 Tetraethylthiuram disulfide ≥97.0% (S) human pricing
193747 Tryptamine 98% human pricing
291277 Undecanoic δ-lactone 98% human pricing
U806 Undecanoic γ-lactone 99% human pricing
C5923 (−)-Cotinine ≥98% human, mouse pricing
C0430 (−)-Cotinine solution drug standard, 1.0 mg/mL in methanol human, mouse pricing
251321 1,5-Dimethylnaphthalene 98% human, mouse pricing
409901 1,7-Dimethylnaphthalene 99% human, mouse pricing
M57006 2-Methylnaphthalene (β) 97% human, mouse pricing
112410 Dimethylnaphthalene, mixture of isomers human, mouse pricing
D9766 Dipyridamole ≥98% (TLC), powder human, mouse pricing
60010 Kaempferol ≥97.0% (HPLC) human, mouse pricing
K0133 Kaempferol ≥90% (HPLC), powder human, mouse pricing
40053 Naphthalene solution certified reference material, 5000 μg/mL in methanol human, mouse pricing
48661 Phenanthrene solution certified reference material, 200 μg/mL in dichloromethane human, mouse pricing
40079 Phenanthrene solution certified reference material, 5000 μg/mL in methanol human, mouse pricing
T0891 Tolbutamide analytical standard human, mouse pricing
46968 Tolbutamide VETRANAL, analytical standard human, mouse pricing
P6273 2-Propylpentanoic acid human, mouse, rat pricing
A3145 Apigenin ≥97% (TLC), from parsley, powder human, mouse, rat pricing
10798 Apigenin ≥95.0% (HPLC) human, mouse, rat pricing
SMB00702 Apigenin ≥97% (TLC), from citrus New human, mouse, rat pricing
C80105 Chrysin 97% human, mouse, rat pricing
C4522 Cimetidine human, mouse, rat pricing
F4043 Fisetin ≥98% human, mouse, rat pricing
F505 Fisetin human, mouse, rat pricing
F2003 Flavone human, mouse, rat pricing
I4883 Ibuprofen ≥98% (GC) human, mouse, rat pricing
I7905 Ibuprofen meets USP testing specifications human, mouse, rat pricing
K1003 Ketoconazole ≥98% (HPLC) human, mouse, rat pricing
UC280 Ketoconazole human, mouse, rat pricing
L9283 Luteolin ≥98% (TLC), powder human, mouse, rat pricing
62696 Luteolin ≥99.0% (TLC) human, mouse, rat pricing
M6760 Myricetin ≥96.0%, crystalline human, mouse, rat pricing
70050 Myricetin ≥96.0% (HPLC) human, mouse, rat pricing
N7634 Nifedipine ≥98% (HPLC), powder human, mouse, rat pricing
R5010 Resveratrol ≥99% (HPLC) human, mouse, rat pricing
W505102 2,6-Diisopropylphenol ≥97% human, rat pricing
D126608 2,6-Diisopropylphenol 97% human, rat pricing
N5757 α-Naphthoflavone human, rat pricing
M2028 Capsaicin ≥95%, from Capsicum sp. human, rat pricing
360376 Capsaicin natural human, rat pricing
21750 Capsaicin from Capsicum sp., ≥50% (HPLC) human, rat pricing
17850 Ciprofloxacin ≥98.0% (HPLC) human, rat pricing
33434 Ciprofloxacin VETRANAL, analytical standard human, rat pricing
F8514 Flurbiprofen cyclooxygenase inhibitor human, rat pricing
282200 Galangin autophagy inducing flavonoid human, rat pricing
L7757 Lidocaine powder human, rat pricing
L1026 Lidocaine analytical standard human, rat pricing
N4126 Nicotinic acid ≥98% human, rat pricing
72309 Nicotinic acid ≥99.5% (HPLC) human, rat pricing
N0765 Nicotinic acid plant cell culture tested human, rat pricing
N0761 Nicotinic acid BioReagent, suitable for cell culture, suitable for insect cell culture, suitable for plant cell culture, ≥98% human, rat pricing
72312 Nicotinic acid Ph Eur human, rat pricing
47864 Nicotinic acid analytical standard human, rat pricing
N5410 Nicotinic acid meets USP testing specifications human, rat pricing
N9890 Norfloxacin analytical standard, ≥98% (TLC) human, rat pricing
33899 Norfloxacin VETRANAL, analytical standard human, rat pricing
T5648 Tamoxifen ≥99% human, rat pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0031 AQUA Peptide YGDVLQI[R] cow, dog, human, mouse, pig, rat pricing
AQ0101 AQUA Peptide YLPNPALQ[R] cow, human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009993 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009993 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009993 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000761 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000761 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000761 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000761 Rosetta Predictions human pricing
NM_012541 Rosetta Predictions rat pricing
NM_009993 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000761 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120422 predicted 606
2 SASI_Hs01_00120423 predicted 1445
3 SASI_Hs01_00120424 predicted 915
4 SASI_Hs01_00120425 predicted 815
5 SASI_Hs01_00120426 predicted 1371
6 SASI_Hs01_00120427 predicted 1271
7 SASI_Hs01_00120428 predicted 964
8 SASI_Hs01_00120429 predicted 1244
9 SASI_Hs01_00120430 predicted 399
10 SASI_Hs01_00120431 predicted 993
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012541 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063175 predicted 381
2 SASI_Rn01_00063176 predicted 797
3 SASI_Rn01_00063177 predicted 600
4 SASI_Rn01_00063178 predicted 724
5 SASI_Rn01_00063179 predicted 546
6 SASI_Rn01_00063180 predicted 1153
7 SASI_Rn01_00063181 predicted 1223
8 SASI_Rn01_00063182 predicted 899
9 SASI_Rn01_00063183 predicted 878
10 SASI_Rn01_00063184 predicted 735
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009993 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317599 predicted 704
2 SASI_Mm01_00181467 predicted 808
3 SASI_Mm01_00181468 predicted 1046
4 SASI_Mm01_00181469 predicted 731
5 SASI_Mm01_00181470 predicted 1257
6 SASI_Mm01_00181471 predicted 1171
7 SASI_Mm01_00181472 predicted 965
8 SASI_Mm01_00181473 predicted 881
9 SASI_Mm01_00181474 predicted 1234
10 SASI_Mm01_00181475 predicted 642
11 SASI_Mm01_00181476 predicted 915
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009993
CYP1A2 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 1, subfamily A, polypeptide 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000193801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009993.2-825s1c1
Sequence:CCGGCAATGATAACTTCGTGCTGTTCTCGAGAACAGCACGAAGTTATCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009993.2-885s1c1
Sequence:CCGGCAAGAACAGTATCCAAGACATCTCGAGATGTCTTGGATACTGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009993.2-1266s1c1
Sequence:CCGGGCGCTGTATCTACATAAACCACTCGAGTGGTTTATGTAGATACAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009993.2-519s1c1
Sequence:CCGGGTCAGCATCCTCTTGCTATTTCTCGAGAAATAGCAAGAGGATGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009993
CYP1A2 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 1, subfamily A, polypeptide 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000193801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009993.2-825s1c1
Sequence:CCGGCAATGATAACTTCGTGCTGTTCTCGAGAACAGCACGAAGTTATCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009993.2-885s1c1
Sequence:CCGGCAAGAACAGTATCCAAGACATCTCGAGATGTCTTGGATACTGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009993.2-1266s1c1
Sequence:CCGGGCGCTGTATCTACATAAACCACTCGAGTGGTTTATGTAGATACAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009993.2-519s1c1
Sequence:CCGGGTCAGCATCCTCTTGCTATTTCTCGAGAAATAGCAAGAGGATGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009993
CYP1A2 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 1, subfamily A, polypeptide 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000193801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009993.2-825s1c1
Sequence:CCGGCAATGATAACTTCGTGCTGTTCTCGAGAACAGCACGAAGTTATCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009993.2-885s1c1
Sequence:CCGGCAAGAACAGTATCCAAGACATCTCGAGATGTCTTGGATACTGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009993.2-1266s1c1
Sequence:CCGGGCGCTGTATCTACATAAACCACTCGAGTGGTTTATGTAGATACAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009993.2-519s1c1
Sequence:CCGGGTCAGCATCCTCTTGCTATTTCTCGAGAAATAGCAAGAGGATGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000761
VALIDATED
CYP1A2 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 1, subfamily A, polypeptide 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_000761.2-1390s1c1
Sequence:CCGGGCCCTTGAGTGAGAAGATGATCTCGAGATCATCTTCTCACTCAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_000761.2-1379s1c1
Sequence:CCGGGCCATTAACAAGCCCTTGAGTCTCGAGACTCAAGGGCTTGTTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000761.2-877s1c1
Sequence:CCGGCTATCAGGACTTTGACAAGAACTCGAGTTCTTGTCAAAGTCCTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_000761.2-970s1c1
Sequence:CCGGCCCACAGGAGAAGATTGTCAACTCGAGTTGACAATCTTCTCCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000761.2-721s1c1
Sequence:CCGGCGTGAAGAACACTCATGAGTTCTCGAGAACTCATGAGTGTTCTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000761.3-1001s21c1
Sequence:CCGGGACATCTTTGGAGCAGGATTTCTCGAGAAATCCTGCTCCAAAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000761.3-1236s21c1
Sequence:CCGGCAAGGGACACAACGCTGAATGCTCGAGCATTCAGCGTTGTGTCCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000761.3-1273s21c1
Sequence:CCGGGAAATGCTGTGTCTTCGTAAACTCGAGTTTACGAAGACACAGCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000761.3-1390s21c1
Sequence:CCGGGCCCTTGAGTGAGAAGATGATCTCGAGATCATCTTCTCACTCAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310684    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000761.3-1958s21c1
Sequence:CCGGGCCATATAATTCACCTTCTTTCTCGAGAAAGAAGGTGAATTATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000761.3-615s21c1
Sequence:CCGGGGCACTTCGACCCTTACAATCCTCGAGGATTGTAAGGGTCGAAGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000761
VALIDATED
CYP1A2 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 1, subfamily A, polypeptide 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_000761.2-1390s1c1
Sequence:CCGGGCCCTTGAGTGAGAAGATGATCTCGAGATCATCTTCTCACTCAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_000761.2-1379s1c1
Sequence:CCGGGCCATTAACAAGCCCTTGAGTCTCGAGACTCAAGGGCTTGTTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000761.2-877s1c1
Sequence:CCGGCTATCAGGACTTTGACAAGAACTCGAGTTCTTGTCAAAGTCCTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_000761.2-970s1c1
Sequence:CCGGCCCACAGGAGAAGATTGTCAACTCGAGTTGACAATCTTCTCCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000761.2-721s1c1
Sequence:CCGGCGTGAAGAACACTCATGAGTTCTCGAGAACTCATGAGTGTTCTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000761.3-1001s21c1
Sequence:CCGGGACATCTTTGGAGCAGGATTTCTCGAGAAATCCTGCTCCAAAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000761.3-1236s21c1
Sequence:CCGGCAAGGGACACAACGCTGAATGCTCGAGCATTCAGCGTTGTGTCCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000761.3-1273s21c1
Sequence:CCGGGAAATGCTGTGTCTTCGTAAACTCGAGTTTACGAAGACACAGCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000761.3-1390s21c1
Sequence:CCGGGCCCTTGAGTGAGAAGATGATCTCGAGATCATCTTCTCACTCAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310684    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000761.3-1958s21c1
Sequence:CCGGGCCATATAATTCACCTTCTTTCTCGAGAAAGAAGGTGAATTATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000761.3-615s21c1
Sequence:CCGGGGCACTTCGACCCTTACAATCCTCGAGGATTGTAAGGGTCGAAGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000761
VALIDATED
CYP1A2 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 1, subfamily A, polypeptide 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_000761.2-1390s1c1
Sequence:CCGGGCCCTTGAGTGAGAAGATGATCTCGAGATCATCTTCTCACTCAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_000761.2-1379s1c1
Sequence:CCGGGCCATTAACAAGCCCTTGAGTCTCGAGACTCAAGGGCTTGTTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000761.2-877s1c1
Sequence:CCGGCTATCAGGACTTTGACAAGAACTCGAGTTCTTGTCAAAGTCCTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_000761.2-970s1c1
Sequence:CCGGCCCACAGGAGAAGATTGTCAACTCGAGTTGACAATCTTCTCCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000761.2-721s1c1
Sequence:CCGGCGTGAAGAACACTCATGAGTTCTCGAGAACTCATGAGTGTTCTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000761.3-1001s21c1
Sequence:CCGGGACATCTTTGGAGCAGGATTTCTCGAGAAATCCTGCTCCAAAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000761.3-1236s21c1
Sequence:CCGGCAAGGGACACAACGCTGAATGCTCGAGCATTCAGCGTTGTGTCCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000761.3-1273s21c1
Sequence:CCGGGAAATGCTGTGTCTTCGTAAACTCGAGTTTACGAAGACACAGCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000761.3-1390s21c1
Sequence:CCGGGCCCTTGAGTGAGAAGATGATCTCGAGATCATCTTCTCACTCAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310684    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000761.3-1958s21c1
Sequence:CCGGGCCATATAATTCACCTTCTTTCTCGAGAAAGAAGGTGAATTATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000761.3-615s21c1
Sequence:CCGGGGCACTTCGACCCTTACAATCCTCGAGGATTGTAAGGGTCGAAGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks