EMAIL THIS PAGE TO A FRIEND

CYP1B1-AS1

CYP1B1 antisense RNA 1

43 Gene Product Result for
Synonyms: C2orf58
Species: Human CYP1B1-AS1(285154)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173652 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173652 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173652 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173652 Rosetta Predictions human pricing
XR_040334 Rosetta Predictions human pricing
XR_040335 Rosetta Predictions human pricing
XR_040336 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173652 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075702 predicted 1355
2 SASI_Hs01_00075703 predicted 469
3 SASI_Hs01_00075704 predicted 611
4 SASI_Hs01_00075705 predicted 1212
5 SASI_Hs01_00075706 predicted 1269
6 SASI_Hs01_00075707 predicted 476
7 SASI_Hs01_00075708 predicted 464
8 SASI_Hs01_00075709 predicted 1327
9 SASI_Hs01_00075710 predicted 1348
10 SASI_Hs01_00075711 predicted 1265
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040334 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517912 predicted 192
2 SASI_Hs02_00517913 predicted 193
3 SASI_Hs02_00517914 predicted 206
4 SASI_Hs02_00517915 predicted 196
5 SASI_Hs02_00517916 predicted 272
6 SASI_Hs02_00517917 predicted 156
7 SASI_Hs02_00517918 predicted 13
8 SASI_Hs02_00517919 predicted 383
9 SASI_Hs02_00517920 predicted 365
10 SASI_Hs02_00517921 predicted 37
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040335 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517922 predicted 193
2 SASI_Hs02_00517923 predicted 196
3 SASI_Hs02_00517924 predicted 204
4 SASI_Hs02_00517925 predicted 191
5 SASI_Hs02_00517926 predicted 154
6 SASI_Hs02_00517927 predicted 124
7 SASI_Hs02_00517928 predicted 18
8 SASI_Hs02_00517929 predicted 379
9 SASI_Hs02_00517930 predicted 366
10 SASI_Hs02_00517931 predicted 41
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040336 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517932 predicted 199
2 SASI_Hs02_00517933 predicted 199
3 SASI_Hs02_00517934 predicted 208
4 SASI_Hs02_00517935 predicted 190
5 SASI_Hs02_00517936 predicted 150
6 SASI_Hs02_00517937 predicted 122
7 SASI_Hs02_00517938 predicted 12
8 SASI_Hs02_00517939 predicted 385
9 SASI_Hs02_00517940 predicted 365
10 SASI_Hs02_00517941 predicted 39
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173652
CYP1B1-AS1 MISSION shRNA Bacterial Glycerol Stock
CYP1B1 antisense RNA 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173652.1-746s1c1
Sequence:CCGGCATTGGAAGTTCAAGCGACTACTCGAGTAGTCGCTTGAACTTCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173652.1-794s1c1
Sequence:CCGGCCTACACTGTGCAACAGATTACTCGAGTAATCTGTTGCACAGTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141153    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173652.1-482s1c1
Sequence:CCGGCAAAGGACTCTTGTAGCCTGTCTCGAGACAGGCTACAAGAGTCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141607    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173652.1-967s1c1
Sequence:CCGGCCACACCCTTTCAGGTGATAACTCGAGTTATCACCTGAAAGGGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173652.1-760s1c1
Sequence:CCGGGCGACTAACTAGGAAACAGGTCTCGAGACCTGTTTCCTAGTTAGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173652.1-836s1c1
Sequence:CCGGCATCCTTTCCTTAGGCTAGATCTCGAGATCTAGCCTAAGGAAAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173652.1-761s1c1
Sequence:CCGGCGACTAACTAGGAAACAGGTTCTCGAGAACCTGTTTCCTAGTTAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173652.1-614s1c1
Sequence:CCGGGCTGTGGATGAATCTCATTATCTCGAGATAATGAGATTCATCCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173652
CYP1B1-AS1 MISSION shRNA shRNA Plasmid DNA
CYP1B1 antisense RNA 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173652.1-746s1c1
Sequence:CCGGCATTGGAAGTTCAAGCGACTACTCGAGTAGTCGCTTGAACTTCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173652.1-794s1c1
Sequence:CCGGCCTACACTGTGCAACAGATTACTCGAGTAATCTGTTGCACAGTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141153    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173652.1-482s1c1
Sequence:CCGGCAAAGGACTCTTGTAGCCTGTCTCGAGACAGGCTACAAGAGTCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141607    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173652.1-967s1c1
Sequence:CCGGCCACACCCTTTCAGGTGATAACTCGAGTTATCACCTGAAAGGGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173652.1-760s1c1
Sequence:CCGGGCGACTAACTAGGAAACAGGTCTCGAGACCTGTTTCCTAGTTAGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173652.1-836s1c1
Sequence:CCGGCATCCTTTCCTTAGGCTAGATCTCGAGATCTAGCCTAAGGAAAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173652.1-761s1c1
Sequence:CCGGCGACTAACTAGGAAACAGGTTCTCGAGAACCTGTTTCCTAGTTAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173652.1-614s1c1
Sequence:CCGGGCTGTGGATGAATCTCATTATCTCGAGATAATGAGATTCATCCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173652
CYP1B1-AS1 MISSION shRNA Lentiviral Transduction Particles
CYP1B1 antisense RNA 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173652.1-746s1c1
Sequence:CCGGCATTGGAAGTTCAAGCGACTACTCGAGTAGTCGCTTGAACTTCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173652.1-794s1c1
Sequence:CCGGCCTACACTGTGCAACAGATTACTCGAGTAATCTGTTGCACAGTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141153    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173652.1-482s1c1
Sequence:CCGGCAAAGGACTCTTGTAGCCTGTCTCGAGACAGGCTACAAGAGTCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141607    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173652.1-967s1c1
Sequence:CCGGCCACACCCTTTCAGGTGATAACTCGAGTTATCACCTGAAAGGGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173652.1-760s1c1
Sequence:CCGGGCGACTAACTAGGAAACAGGTCTCGAGACCTGTTTCCTAGTTAGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173652.1-836s1c1
Sequence:CCGGCATCCTTTCCTTAGGCTAGATCTCGAGATCTAGCCTAAGGAAAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173652.1-761s1c1
Sequence:CCGGCGACTAACTAGGAAACAGGTTCTCGAGAACCTGTTTCCTAGTTAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173652.1-614s1c1
Sequence:CCGGGCTGTGGATGAATCTCATTATCTCGAGATAATGAGATTCATCCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks