EMAIL THIS PAGE TO A FRIEND

CYP1B1

cytochrome P450, family 1, subfamily B, polypeptide 1

Synonyms: CP1B CYPIB1 GLC3A P4501B1
UniProtKB ID: Q16678, Q5TZW8, Q93089, Q9H316
Gene ID:
Human(1545) Summary: This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. The enzyme encoded by this gene localizes to the endoplasmic reticulum and metabolizes procarcinogens such as polycyclic aromatic hydrocarbons and 17beta-estradiol. Mutations in this gene have been associated with primary congenital glaucoma; therefore it is thought that the enzyme also metabolizes a signaling molecule involved in eye development, possibly a steroid. [provided by RefSeq, Jul 2008]
Mouse(13078) cytochrome P450, family 1, subfamily b, polypeptide 1
Rat(25426) cytochrome P450, family 1, subfamily b, polypeptide 1
Zebrafish(100150054) cytochrome P450, family 1, subfamily B, polypeptide 1
cow(511470) cytochrome P450, family 1, subfamily B, polypeptide 1
dog(483038) cytochrome P450, family 1, subfamily B, polypeptide 1
chicken(428832) cytochrome P450, family 1, subfamily B, polypeptide 1
chicken(421466) cytochrome P450, family 1, subfamily B, polypeptide 1
105 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
R3277 Rutaecarpine >98% (HPLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009994 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009994 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009994 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000104 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000104 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000104 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU014811 MISSION® esiRNA esiRNA targeting human CYP1B1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000104 Rosetta Predictions human pricing
NM_012940 Rosetta Predictions rat pricing
XM_579361 Rosetta Predictions rat pricing
NM_009994 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000104 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020012 predicted 814
2 SASI_Hs02_00301876 predicted 1775
3 SASI_Hs01_00020014 predicted 403
4 SASI_Hs01_00020015 predicted 1682
5 SASI_Hs01_00020016 predicted 1785
6 SASI_Hs01_00020017 predicted 1508
7 SASI_Hs01_00020018 predicted 2224
8 SASI_Hs02_00301877 predicted 1640
9 SASI_Hs01_00020019 predicted 1997
10 SASI_Hs02_00301878 predicted 1715
11 SASI_Hs01_00020013 predicted 1509
12 SASI_Hs01_00020020 predicted 1890
13 SASI_Hs01_00020021 predicted 989
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012940 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108854 predicted 2013
2 SASI_Rn01_00108855 predicted 429
3 SASI_Rn01_00108856 predicted 1838
4 SASI_Rn01_00108857 predicted 1895
5 SASI_Rn02_00260504 predicted 1794
6 SASI_Rn01_00108860 predicted 972
7 SASI_Rn01_00108861 predicted 1878
8 SASI_Rn01_00108862 predicted 952
9 SASI_Rn01_00108863 predicted 1625
10 SASI_Rn02_00260505 predicted 1662
11 SASI_Rn01_00108858 predicted 1160
12 SASI_Rn01_00108859 predicted 420
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579361 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00127458 predicted 533
2 SASI_Rn01_00127459 predicted 897
3 SASI_Rn01_00127460 predicted 436
4 SASI_Rn01_00127461 predicted 1161
5 SASI_Rn01_00127462 predicted 415
6 SASI_Rn01_00127463 predicted 971
7 SASI_Rn01_00127464 predicted 993
8 SASI_Rn01_00127465 predicted 400
9 SASI_Rn01_00127466 predicted 967
10 SASI_Rn01_00127467 predicted 1031
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009994 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051239 predicted 1878
2 SASI_Mm01_00051240 predicted 2009
3 SASI_Mm01_00051241 predicted 1775
4 SASI_Mm01_00051242 predicted 1865
5 SASI_Mm01_00051244 predicted 2085
6 SASI_Mm01_00051245 predicted 1618
7 SASI_Mm01_00051246 predicted 1724
8 SASI_Mm01_00051247 predicted 1853
9 SASI_Mm01_00051248 predicted 1147
10 SASI_Mm02_00317600 predicted 1699
11 SASI_Mm01_00051243 predicted 1826
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009994
VALIDATED
CYP1B1 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 1, subfamily B, polypeptide 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009994.1-1872s21c1
Sequence:CCGGAGTTATGGCCTGACCATTAAGCTCGAGCTTAATGGTCAGGCCATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250438    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009994.1-4716s21c1
Sequence:CCGGAGGTGTGTTTGATGGATTAATCTCGAGATTAATCCATCAAACACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009994.1-1383s21c1
Sequence:CCGGCTCATCCTCTTTACCAGATACCTCGAGGTATCTGGTAAAGAGGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009994.1-1693s21c1
Sequence:CCGGTGGACAAGGACGGCTTCATTACTCGAGTAATGAAGCCGTCCTTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009994.1-1723s21c1
Sequence:CCGGTAGCCAGCAGTGTGATGATATCTCGAGATATCATCACACTGCTGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009994
VALIDATED
CYP1B1 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 1, subfamily B, polypeptide 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009994.1-1872s21c1
Sequence:CCGGAGTTATGGCCTGACCATTAAGCTCGAGCTTAATGGTCAGGCCATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250438    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009994.1-4716s21c1
Sequence:CCGGAGGTGTGTTTGATGGATTAATCTCGAGATTAATCCATCAAACACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009994.1-1383s21c1
Sequence:CCGGCTCATCCTCTTTACCAGATACCTCGAGGTATCTGGTAAAGAGGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009994.1-1693s21c1
Sequence:CCGGTGGACAAGGACGGCTTCATTACTCGAGTAATGAAGCCGTCCTTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009994.1-1723s21c1
Sequence:CCGGTAGCCAGCAGTGTGATGATATCTCGAGATATCATCACACTGCTGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009994
VALIDATED
CYP1B1 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 1, subfamily B, polypeptide 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009994.1-1872s21c1
Sequence:CCGGAGTTATGGCCTGACCATTAAGCTCGAGCTTAATGGTCAGGCCATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250438    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009994.1-4716s21c1
Sequence:CCGGAGGTGTGTTTGATGGATTAATCTCGAGATTAATCCATCAAACACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009994.1-1383s21c1
Sequence:CCGGCTCATCCTCTTTACCAGATACCTCGAGGTATCTGGTAAAGAGGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009994.1-1693s21c1
Sequence:CCGGTGGACAAGGACGGCTTCATTACTCGAGTAATGAAGCCGTCCTTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009994.1-1723s21c1
Sequence:CCGGTAGCCAGCAGTGTGATGATATCTCGAGATATCATCACACTGCTGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000104
VALIDATED
CYP1B1 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 1, subfamily B, polypeptide 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000104.2-1524s1c1
Sequence:CCGGCCTTTATGAAGCCATGCGCTTCTCGAGAAGCGCATGGCTTCATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_000104.2-1176s1c1
Sequence:CCGGCAGCAACTTCATCCTGGACAACTCGAGTTGTCCAGGATGAAGTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000104.2-1781s1c1
Sequence:CCGGGCATTGGCGAAGAACTTTCTACTCGAGTAGAAAGTTCTTCGCCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_000104.2-1240s1c1
Sequence:CCGGCGCGACATGATGGACGCCTTTCTCGAGAAAGGCGTCCATCATGTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_000104.2-1909s1c1
Sequence:CCGGCCCAAGTCATTTAAAGTCAATCTCGAGATTGACTTTAAATGACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000104
VALIDATED
CYP1B1 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 1, subfamily B, polypeptide 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000104.2-1524s1c1
Sequence:CCGGCCTTTATGAAGCCATGCGCTTCTCGAGAAGCGCATGGCTTCATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_000104.2-1176s1c1
Sequence:CCGGCAGCAACTTCATCCTGGACAACTCGAGTTGTCCAGGATGAAGTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000104.2-1781s1c1
Sequence:CCGGGCATTGGCGAAGAACTTTCTACTCGAGTAGAAAGTTCTTCGCCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_000104.2-1240s1c1
Sequence:CCGGCGCGACATGATGGACGCCTTTCTCGAGAAAGGCGTCCATCATGTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_000104.2-1909s1c1
Sequence:CCGGCCCAAGTCATTTAAAGTCAATCTCGAGATTGACTTTAAATGACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000104
VALIDATED
CYP1B1 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 1, subfamily B, polypeptide 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000104.2-1524s1c1
Sequence:CCGGCCTTTATGAAGCCATGCGCTTCTCGAGAAGCGCATGGCTTCATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_000104.2-1176s1c1
Sequence:CCGGCAGCAACTTCATCCTGGACAACTCGAGTTGTCCAGGATGAAGTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000104.2-1781s1c1
Sequence:CCGGGCATTGGCGAAGAACTTTCTACTCGAGTAGAAAGTTCTTCGCCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_000104.2-1240s1c1
Sequence:CCGGCGCGACATGATGGACGCCTTTCTCGAGAAAGGCGTCCATCATGTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_000104.2-1909s1c1
Sequence:CCGGCCCAAGTCATTTAAAGTCAATCTCGAGATTGACTTTAAATGACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks