EMAIL THIS PAGE TO A FRIEND

CYP20A1

cytochrome P450, family 20, subfamily A, polypeptide 1

70 Gene Product Result for
Synonyms: CYP-M
UniProtKB ID: Q6UW02, Q4ZG61, Q8N4Q8, Q8WWA9
Gene ID:
Human(57404) Summary: This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases that catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein lacks one amino acid of the conserved heme binding site. It also lacks the conserved I-helix motif AGX(D,E)T, suggesting that its substrate may carry its own oxygen. [provided by RefSeq, Jul 2008]
Mouse(77951) cytochrome P450, family 20, subfamily a, polypeptide 1
Rat(316435) cytochrome P450, family 20, subfamily a, polypeptide 1
Zebrafish(406641) cytochrome P450, family 20, subfamily A, polypeptide 1
chicken(431682) cytochrome P450, family 20, subfamily A, polypeptide 1
cow(532945) cytochrome P450, family 20, subfamily A, polypeptide 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020674 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020674 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020674 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030013 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030013 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030013 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_177538 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_177538 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_177538 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020674 Rosetta Predictions human pricing
NM_177538 Rosetta Predictions human pricing
NM_199401 Rosetta Predictions rat pricing
NM_030013 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020674 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00247464 predicted 1452
2 SASI_Hs01_00247465 predicted 1447
3 SASI_Hs01_00247466 predicted 688
4 SASI_Hs01_00247467 predicted 1431
5 SASI_Hs01_00247468 predicted 469
6 SASI_Hs01_00247469 predicted 542
7 SASI_Hs01_00247470 predicted 684
8 SASI_Hs01_00247471 predicted 687
9 SASI_Hs01_00247472 predicted 433
10 SASI_Hs01_00247473 predicted 623
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177538 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369382 predicted 1248
2 SASI_Hs02_00369383 predicted 881
3 SASI_Hs02_00369384 predicted 1153
4 SASI_Hs02_00369385 predicted 1137
5 SASI_Hs01_00053711 predicted 1770
6 SASI_Hs02_00369386 predicted 793
7 SASI_Hs01_00053712 predicted 924
8 SASI_Hs01_00053713 predicted 1754
9 SASI_Hs02_00369387 predicted 1217
10 SASI_Hs02_00369388 predicted 635
11 SASI_Hs01_00053710 predicted 1531
12 SASI_Hs01_00053714 predicted 466
13 SASI_Hs01_00053715 predicted 551
14 SASI_Hs01_00053716 predicted 687
15 SASI_Hs01_00053717 predicted 692
16 SASI_Hs01_00053718 predicted 440
17 SASI_Hs01_00053719 predicted 622
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199401 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044578 predicted 671
2 SASI_Rn02_00270227 predicted 909
3 SASI_Rn01_00044579 predicted 1013
4 SASI_Rn01_00044580 predicted 725
5 SASI_Rn01_00044581 predicted 1428
6 SASI_Rn01_00044582 predicted 484
7 SASI_Rn01_00044583 predicted 791
8 SASI_Rn01_00044584 predicted 811
9 SASI_Rn01_00044585 predicted 1327
10 SASI_Rn01_00044586 predicted 1524
11 SASI_Rn01_00044587 predicted 1283
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030013 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090041 predicted 1237
2 SASI_Mm01_00090042 predicted 633
3 SASI_Mm01_00090043 predicted 443
4 SASI_Mm01_00090044 predicted 946
5 SASI_Mm01_00090046 predicted 1158
6 SASI_Mm01_00090047 predicted 1016
7 SASI_Mm02_00336373 predicted 301
8 SASI_Mm01_00090049 predicted 241
9 SASI_Mm02_00336374 predicted 449
10 SASI_Mm02_00336375 predicted 312
11 SASI_Mm01_00090045 predicted 989
12 SASI_Mm01_00090048 predicted 1085
13 SASI_Mm01_00090050 predicted 1008
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020674
VALIDATED
CYP20A1 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 20, subfamily A, polypeptide 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020674.2-682s1c1
Sequence:CCGGGCTGAAGTCATTATTAAGGTACTCGAGTACCTTAATAATGACTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020674.2-976s1c1
Sequence:CCGGCTCATGCAACTGGAGTCTGTTCTCGAGAACAGACTCCAGTTGCATGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020674.2-470s1c1
Sequence:CCGGCCAGGGATTACTCCAACTGAACTCGAGTTCAGTTGGAGTAATCCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020674.2-497s1c1
Sequence:CCGGGATGGTAATCTTCCAGATATTCTCGAGAATATCTGGAAGATTACCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020674.2-799s1c1
Sequence:CCGGCCTAAAGCTTTCAGAAGAATTCTCGAGAATTCTTCTGAAAGCTTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020674
VALIDATED
CYP20A1 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 20, subfamily A, polypeptide 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020674.2-682s1c1
Sequence:CCGGGCTGAAGTCATTATTAAGGTACTCGAGTACCTTAATAATGACTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020674.2-976s1c1
Sequence:CCGGCTCATGCAACTGGAGTCTGTTCTCGAGAACAGACTCCAGTTGCATGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020674.2-470s1c1
Sequence:CCGGCCAGGGATTACTCCAACTGAACTCGAGTTCAGTTGGAGTAATCCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020674.2-497s1c1
Sequence:CCGGGATGGTAATCTTCCAGATATTCTCGAGAATATCTGGAAGATTACCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020674.2-799s1c1
Sequence:CCGGCCTAAAGCTTTCAGAAGAATTCTCGAGAATTCTTCTGAAAGCTTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020674
VALIDATED
CYP20A1 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 20, subfamily A, polypeptide 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020674.2-682s1c1
Sequence:CCGGGCTGAAGTCATTATTAAGGTACTCGAGTACCTTAATAATGACTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020674.2-976s1c1
Sequence:CCGGCTCATGCAACTGGAGTCTGTTCTCGAGAACAGACTCCAGTTGCATGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020674.2-470s1c1
Sequence:CCGGCCAGGGATTACTCCAACTGAACTCGAGTTCAGTTGGAGTAATCCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020674.2-497s1c1
Sequence:CCGGGATGGTAATCTTCCAGATATTCTCGAGAATATCTGGAAGATTACCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020674.2-799s1c1
Sequence:CCGGCCTAAAGCTTTCAGAAGAATTCTCGAGAATTCTTCTGAAAGCTTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030013
VALIDATED
CYP20A1 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 20, subfamily A, polypeptide 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030013.1-311s1c1
Sequence:CCGGCCCATTTGAAACCATGTTGAACTCGAGTTCAACATGGTTTCAAATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030013.1-179s1c1
Sequence:CCGGGCATGAGTTCCTGGTTAATTTCTCGAGAAATTAACCAGGAACTCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030013.1-848s1c1
Sequence:CCGGCTGCATAATAACTGCAAGGTTCTCGAGAACCTTGCAGTTATTATGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030013.1-704s1c1
Sequence:CCGGGCAATTGGAATCCACTTTAAACTCGAGTTTAAAGTGGATTCCAATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030013.1-141s1c1
Sequence:CCGGGATGGTAATCTTCCAGACATTCTCGAGAATGTCTGGAAGATTACCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030013
VALIDATED
CYP20A1 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 20, subfamily A, polypeptide 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030013.1-311s1c1
Sequence:CCGGCCCATTTGAAACCATGTTGAACTCGAGTTCAACATGGTTTCAAATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030013.1-179s1c1
Sequence:CCGGGCATGAGTTCCTGGTTAATTTCTCGAGAAATTAACCAGGAACTCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030013.1-848s1c1
Sequence:CCGGCTGCATAATAACTGCAAGGTTCTCGAGAACCTTGCAGTTATTATGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030013.1-704s1c1
Sequence:CCGGGCAATTGGAATCCACTTTAAACTCGAGTTTAAAGTGGATTCCAATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030013.1-141s1c1
Sequence:CCGGGATGGTAATCTTCCAGACATTCTCGAGAATGTCTGGAAGATTACCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030013
VALIDATED
CYP20A1 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 20, subfamily A, polypeptide 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030013.1-311s1c1
Sequence:CCGGCCCATTTGAAACCATGTTGAACTCGAGTTCAACATGGTTTCAAATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030013.1-179s1c1
Sequence:CCGGGCATGAGTTCCTGGTTAATTTCTCGAGAAATTAACCAGGAACTCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030013.1-848s1c1
Sequence:CCGGCTGCATAATAACTGCAAGGTTCTCGAGAACCTTGCAGTTATTATGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030013.1-704s1c1
Sequence:CCGGGCAATTGGAATCCACTTTAAACTCGAGTTTAAAGTGGATTCCAATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030013.1-141s1c1
Sequence:CCGGGATGGTAATCTTCCAGACATTCTCGAGAATGTCTGGAAGATTACCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177538
CYP20A1 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 20, subfamily A, polypeptide 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284387    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177538.2-5017s21c1
Sequence:CCGGATTATCCCTTCCCACTTATTTCTCGAGAAATAAGTGGGAAGGGATAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177538.2-1388s21c1
Sequence:CCGGTTAGTACAAGGGAACCTTAATCTCGAGATTAAGGTTCCCTTGTACTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177538.2-1922s21c1
Sequence:CCGGTCTGTGGAGGGACAGGTTATTCTCGAGAATAACCTGTCCCTCCACAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177538.2-1781s21c1
Sequence:CCGGGATCGGTTTGATGATGAATTACTCGAGTAATTCATCATCAAACCGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177538.2-1355s21c1
Sequence:CCGGAGGAACTTCAGTCAACATATTCTCGAGAATATGTTGACTGAAGTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177538
CYP20A1 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 20, subfamily A, polypeptide 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284387    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177538.2-5017s21c1
Sequence:CCGGATTATCCCTTCCCACTTATTTCTCGAGAAATAAGTGGGAAGGGATAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177538.2-1388s21c1
Sequence:CCGGTTAGTACAAGGGAACCTTAATCTCGAGATTAAGGTTCCCTTGTACTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177538.2-1922s21c1
Sequence:CCGGTCTGTGGAGGGACAGGTTATTCTCGAGAATAACCTGTCCCTCCACAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177538.2-1781s21c1
Sequence:CCGGGATCGGTTTGATGATGAATTACTCGAGTAATTCATCATCAAACCGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177538.2-1355s21c1
Sequence:CCGGAGGAACTTCAGTCAACATATTCTCGAGAATATGTTGACTGAAGTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177538
CYP20A1 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 20, subfamily A, polypeptide 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284387    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177538.2-5017s21c1
Sequence:CCGGATTATCCCTTCCCACTTATTTCTCGAGAAATAAGTGGGAAGGGATAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177538.2-1388s21c1
Sequence:CCGGTTAGTACAAGGGAACCTTAATCTCGAGATTAAGGTTCCCTTGTACTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177538.2-1922s21c1
Sequence:CCGGTCTGTGGAGGGACAGGTTATTCTCGAGAATAACCTGTCCCTCCACAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177538.2-1781s21c1
Sequence:CCGGGATCGGTTTGATGATGAATTACTCGAGTAATTCATCATCAAACCGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177538.2-1355s21c1
Sequence:CCGGAGGAACTTCAGTCAACATATTCTCGAGAATATGTTGACTGAAGTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)