EMAIL THIS PAGE TO A FRIEND

CYP24A1

cytochrome P450, family 24, subfamily A, polypeptide 1

60 Gene Product Result for
Synonyms: CP24 CYP24 HCAI P450-CC24
UniProtKB ID: Q07973, Q15807, Q32ML3
Gene ID:
Human(1591) Summary: This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This mitochondrial protein initiates the degradation of 1,25-dihydroxyvitamin D3, the physiologically active form of vitamin D3, by hydroxylation of the side chain. In regulating the level of vitamin D3, this enzyme plays a role in calcium homeostasis and the vitamin D endocrine system. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(13081) cytochrome P450, family 24, subfamily a, polypeptide 1
Rat(25279) cytochrome P450, family 24, subfamily a, polypeptide 1
Zebrafish(100004700) cytochrome P450, family 24, subfamily A, polypeptide 1
cow(540080) cytochrome P450, family 24, subfamily A, polypeptide 1
domestic cat(101096141) cytochrome P450, family 24, subfamily A, polypeptide 1
dog(485935) cytochrome P450, family 24, subfamily A, polypeptide 1
chicken(395827) cytochrome P450, family 24, subfamily A, polypeptide 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
K1003 Ketoconazole ≥98% (HPLC) human, mouse, rat pricing
UC280 Ketoconazole human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000782 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000782 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000782 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009996 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009996 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009996 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU002561 MISSION® esiRNA esiRNA targeting human CYP24A1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000782 Rosetta Predictions human pricing
NM_201635 Rosetta Predictions rat pricing
NM_009996 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000782 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080775 predicted 1866
2 SASI_Hs01_00080776 predicted 1294
3 SASI_Hs01_00080777 predicted 1042
4 SASI_Hs01_00080779 predicted 1818
5 SASI_Hs01_00080780 predicted 1404
6 SASI_Hs01_00080781 predicted 1782
7 SASI_Hs02_00303221 predicted 667
8 SASI_Hs01_00080782 predicted 1007
9 SASI_Hs01_00080783 predicted 1611
10 SASI_Hs01_00080784 predicted 1593
11 SASI_Hs01_00080778 predicted 697
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201635 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062016 predicted 898
2 SASI_Rn02_00270335 predicted 1105
3 SASI_Rn02_00270336 predicted 889
4 SASI_Rn01_00062020 predicted 1261
5 SASI_Rn02_00270337 predicted 994
6 SASI_Rn01_00062022 predicted 803
7 SASI_Rn01_00062024 predicted 1286
8 SASI_Rn01_00062025 predicted 287
9 SASI_Rn02_00270338 predicted 1011
10 SASI_Rn02_00270339 predicted 1191
11 SASI_Rn01_00062017 predicted 1893
12 SASI_Rn01_00062018 predicted 1017
13 SASI_Rn01_00062019 predicted 612
14 SASI_Rn01_00062021 predicted 1572
15 SASI_Rn01_00062023 predicted 1628
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009996 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106936 predicted 1253
2 SASI_Mm01_00106937 predicted 1026
3 SASI_Mm01_00106938 predicted 1586
4 SASI_Mm01_00106939 predicted 1471
5 SASI_Mm01_00106940 predicted 1488
6 SASI_Mm01_00106941 predicted 1362
7 SASI_Mm01_00106942 predicted 1656
8 SASI_Mm01_00106943 predicted 499
9 SASI_Mm01_00106944 predicted 622
10 SASI_Mm01_00106945 predicted 899
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000782
VALIDATED
CYP24A1 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 24, subfamily A, polypeptide 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_000782.2-1296s1c1
Sequence:CCGGGCAGATTTCCTTTGTGACATTCTCGAGAATGTCACAAAGGAAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000782.2-696s1c1
Sequence:CCGGCGCATGAAGTTGGGTTCCTTTCTCGAGAAAGGAACCCAACTTCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000782.2-1395s1c1
Sequence:CCGGGCAAACAGTCTAATGTGGATTCTCGAGAATCCACATTAGACTGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_000782.2-1016s1c1
Sequence:CCGGCGAACTGAACAAATGGTCGTTCTCGAGAACGACCATTTGTTCAGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000782.2-1500s1c1
Sequence:CCGGCGGGAGGAAGATTTGAGGAATCTCGAGATTCCTCAAATCTTCCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000782.4-1558s21c1
Sequence:CCGGTTACGCCGAGTGTACCATTTACTCGAGTAAATGGTACACTCGGCGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000782.4-1509s21c1
Sequence:CCGGTTGAGGAATATGCCGTATTTACTCGAGTAAATACGGCATATTCCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000782.4-1293s21c1
Sequence:CCGGGCAGATTTCCTTTGTGACATTCTCGAGAATGTCACAAAGGAAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296281    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000782.4-2274s21c1
Sequence:CCGGAGTAATACTGACAATCCATTTCTCGAGAAATGGATTGTCAGTATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000782.4-935s21c1
Sequence:CCGGCAATGAGGTCTTGGCCGATTTCTCGAGAAATCGGCCAAGACCTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000782
VALIDATED
CYP24A1 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 24, subfamily A, polypeptide 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_000782.2-1296s1c1
Sequence:CCGGGCAGATTTCCTTTGTGACATTCTCGAGAATGTCACAAAGGAAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000782.2-696s1c1
Sequence:CCGGCGCATGAAGTTGGGTTCCTTTCTCGAGAAAGGAACCCAACTTCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000782.2-1395s1c1
Sequence:CCGGGCAAACAGTCTAATGTGGATTCTCGAGAATCCACATTAGACTGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_000782.2-1016s1c1
Sequence:CCGGCGAACTGAACAAATGGTCGTTCTCGAGAACGACCATTTGTTCAGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000782.2-1500s1c1
Sequence:CCGGCGGGAGGAAGATTTGAGGAATCTCGAGATTCCTCAAATCTTCCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000782.4-1558s21c1
Sequence:CCGGTTACGCCGAGTGTACCATTTACTCGAGTAAATGGTACACTCGGCGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000782.4-1509s21c1
Sequence:CCGGTTGAGGAATATGCCGTATTTACTCGAGTAAATACGGCATATTCCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000782.4-1293s21c1
Sequence:CCGGGCAGATTTCCTTTGTGACATTCTCGAGAATGTCACAAAGGAAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296281    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000782.4-2274s21c1
Sequence:CCGGAGTAATACTGACAATCCATTTCTCGAGAAATGGATTGTCAGTATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000782.4-935s21c1
Sequence:CCGGCAATGAGGTCTTGGCCGATTTCTCGAGAAATCGGCCAAGACCTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000782
VALIDATED
CYP24A1 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 24, subfamily A, polypeptide 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_000782.2-1296s1c1
Sequence:CCGGGCAGATTTCCTTTGTGACATTCTCGAGAATGTCACAAAGGAAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000782.2-696s1c1
Sequence:CCGGCGCATGAAGTTGGGTTCCTTTCTCGAGAAAGGAACCCAACTTCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000782.2-1395s1c1
Sequence:CCGGGCAAACAGTCTAATGTGGATTCTCGAGAATCCACATTAGACTGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_000782.2-1016s1c1
Sequence:CCGGCGAACTGAACAAATGGTCGTTCTCGAGAACGACCATTTGTTCAGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000782.2-1500s1c1
Sequence:CCGGCGGGAGGAAGATTTGAGGAATCTCGAGATTCCTCAAATCTTCCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000782.4-1558s21c1
Sequence:CCGGTTACGCCGAGTGTACCATTTACTCGAGTAAATGGTACACTCGGCGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000782.4-1509s21c1
Sequence:CCGGTTGAGGAATATGCCGTATTTACTCGAGTAAATACGGCATATTCCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000782.4-1293s21c1
Sequence:CCGGGCAGATTTCCTTTGTGACATTCTCGAGAATGTCACAAAGGAAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296281    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000782.4-2274s21c1
Sequence:CCGGAGTAATACTGACAATCCATTTCTCGAGAAATGGATTGTCAGTATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000782.4-935s21c1
Sequence:CCGGCAATGAGGTCTTGGCCGATTTCTCGAGAAATCGGCCAAGACCTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009996
CYP24A1 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 24, subfamily A, polypeptide 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009996.2-1487s1c1
Sequence:CCGGCCCTATTTAAAGGCCTGTCTACTCGAGTAGACAGGCCTTTAAATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009996.2-1604s1c1
Sequence:CCGGGTCTTAACACTAAATACCCAACTCGAGTTGGGTATTTAGTGTTAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176860    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009996.2-2919s1c1
Sequence:CCGGGCACAATTTCATAAACGCAAACTCGAGTTTGCGTTTATGAAATTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200060    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009996.2-1201s1c1
Sequence:CCGGCAAATCAGTCAAGCCCTGCATCTCGAGATGCAGGGCTTGACTGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009996.2-1259s1c1
Sequence:CCGGGCGGATTTCCTTTGTGATATTCTCGAGAATATCACAAAGGAAATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009996.2-623s1c1
Sequence:CCGGGCAGAGTACCACAAGAAGTATCTCGAGATACTTCTTGTGGTACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009996.2-1011s1c1
Sequence:CCGGGCCTTGTGTTATATGAGAAGACTCGAGTCTTCTCATATAACACAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217822    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009996.3-2142s1c1
Sequence:CCGGCAACACTTTACCACGTGTTTACTCGAGTAAACACGTGGTAAAGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009996
CYP24A1 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 24, subfamily A, polypeptide 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009996.2-1487s1c1
Sequence:CCGGCCCTATTTAAAGGCCTGTCTACTCGAGTAGACAGGCCTTTAAATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009996.2-1604s1c1
Sequence:CCGGGTCTTAACACTAAATACCCAACTCGAGTTGGGTATTTAGTGTTAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176860    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009996.2-2919s1c1
Sequence:CCGGGCACAATTTCATAAACGCAAACTCGAGTTTGCGTTTATGAAATTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200060    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009996.2-1201s1c1
Sequence:CCGGCAAATCAGTCAAGCCCTGCATCTCGAGATGCAGGGCTTGACTGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009996.2-1259s1c1
Sequence:CCGGGCGGATTTCCTTTGTGATATTCTCGAGAATATCACAAAGGAAATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009996.2-623s1c1
Sequence:CCGGGCAGAGTACCACAAGAAGTATCTCGAGATACTTCTTGTGGTACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009996.2-1011s1c1
Sequence:CCGGGCCTTGTGTTATATGAGAAGACTCGAGTCTTCTCATATAACACAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217822    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009996.3-2142s1c1
Sequence:CCGGCAACACTTTACCACGTGTTTACTCGAGTAAACACGTGGTAAAGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009996
CYP24A1 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 24, subfamily A, polypeptide 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009996.2-1487s1c1
Sequence:CCGGCCCTATTTAAAGGCCTGTCTACTCGAGTAGACAGGCCTTTAAATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009996.2-1604s1c1
Sequence:CCGGGTCTTAACACTAAATACCCAACTCGAGTTGGGTATTTAGTGTTAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176860    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009996.2-2919s1c1
Sequence:CCGGGCACAATTTCATAAACGCAAACTCGAGTTTGCGTTTATGAAATTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200060    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009996.2-1201s1c1
Sequence:CCGGCAAATCAGTCAAGCCCTGCATCTCGAGATGCAGGGCTTGACTGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009996.2-1259s1c1
Sequence:CCGGGCGGATTTCCTTTGTGATATTCTCGAGAATATCACAAAGGAAATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009996.2-623s1c1
Sequence:CCGGGCAGAGTACCACAAGAAGTATCTCGAGATACTTCTTGTGGTACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009996.2-1011s1c1
Sequence:CCGGGCCTTGTGTTATATGAGAAGACTCGAGTCTTCTCATATAACACAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217822    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009996.3-2142s1c1
Sequence:CCGGCAACACTTTACCACGTGTTTACTCGAGTAAACACGTGGTAAAGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks