EMAIL THIS PAGE TO A FRIEND

CYP26A1

cytochrome P450, family 26, subfamily A, polypeptide 1

70 Gene Product Result for
Synonyms: CP26 CYP26 P450RAI P450RAI1
UniProtKB ID: O43174, B3KNI4, Q5VXH9, Q5VXI0
Gene ID:
Human(1592) Summary: This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum protein acts on retinoids, including all-trans-retinoic acid (RA), with both 4-hydroxylation and 18-hydroxylation activities. This enzyme regulates the cellular level of retinoic acid which is involved in regulation of gene expression in both embryonic and adult tissues. Two alternatively spliced transcript variants of this gene, which encode the distinct isoforms, have been reported. [provided by RefSeq, Jul 2008]
Mouse(13082) cytochrome P450, family 26, subfamily a, polypeptide 1
Rat(154985) cytochrome P450, family 26, subfamily a, polypeptide 1
Zebrafish(30381) cytochrome P450, subfamily XXVIA, polypeptide 1
chicken(408183) cytochrome P450, family 26, subfamily A, polypeptide 1
cow(539047) cytochrome P450, family 26, subfamily A, polypeptide 1
dog(486804) cytochrome P450, family 26, subfamily A, polypeptide 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
K1003 Ketoconazole ≥98% (HPLC) human, mouse, rat pricing
UC280 Ketoconazole human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000783 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000783 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000783 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007811 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007811 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007811 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000783 Rosetta Predictions human pricing
NM_057157 Rosetta Predictions human pricing
NM_130408 Rosetta Predictions rat pricing
NM_007811 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000783 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133960 predicted 882
2 SASI_Hs01_00133962 predicted 1001
3 SASI_Hs01_00133964 predicted 569
4 SASI_Hs01_00133965 predicted 1337
5 SASI_Hs01_00133966 predicted 1339
6 SASI_Hs01_00133967 predicted 999
7 SASI_Hs02_00303222 predicted 1237
8 SASI_Hs01_00133968 predicted 1142
9 SASI_Hs01_00133969 predicted 1342
10 SASI_Hs02_00303223 predicted 909
11 SASI_Hs01_00133961 predicted 1261
12 SASI_Hs01_00133963 predicted 1299
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057157 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203805 predicted 1034
2 SASI_Hs01_00203807 predicted 1146
3 SASI_Hs01_00203809 predicted 714
4 SASI_Hs01_00203810 predicted 1477
5 SASI_Hs01_00203811 predicted 1493
6 SASI_Hs01_00203812 predicted 1145
7 SASI_Hs02_00362011 predicted 1389
8 SASI_Hs01_00203813 predicted 1283
9 SASI_Hs01_00203814 predicted 1491
10 SASI_Hs02_00362012 predicted 1055
11 SASI_Hs01_00203806 predicted 1413
12 SASI_Hs01_00203808 predicted 1455
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130408 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038389 predicted 245
2 SASI_Rn01_00038390 predicted 442
3 SASI_Rn01_00038391 predicted 1209
4 SASI_Rn01_00038392 predicted 451
5 SASI_Rn01_00038393 predicted 930
6 SASI_Rn02_00267397 predicted 1066
7 SASI_Rn01_00038394 predicted 306
8 SASI_Rn01_00038396 predicted 1098
9 SASI_Rn01_00038398 predicted 1265
10 SASI_Rn02_00267398 predicted 1230
11 SASI_Rn01_00038395 predicted 235
12 SASI_Rn01_00038397 predicted 589
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007811 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123292 predicted 1058
2 SASI_Mm01_00123293 predicted 1336
3 SASI_Mm01_00123294 predicted 1314
4 SASI_Mm01_00123295 predicted 502
5 SASI_Mm01_00123296 predicted 319
6 SASI_Mm01_00123297 predicted 1322
7 SASI_Mm01_00123298 predicted 376
8 SASI_Mm01_00123299 predicted 515
9 SASI_Mm02_00312527 predicted 241
10 SASI_Mm01_00123300 predicted 741
11 SASI_Mm01_00123301 predicted 228
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000783
VALIDATED
CYP26A1 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 26, subfamily A, polypeptide 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000296285    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000783.3-1657s21c1
Sequence:CCGGACTATACTACCACAATCTTTACTCGAGTAAAGATTGTGGTAGTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000783.3-1503s21c1
Sequence:CCGGCCCTGCAAGATTCACCCATTTCTCGAGAAATGGGTGAATCTTGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000783.3-1102s21c1
Sequence:CCGGCTTAAATACATCGGGTGTGTTCTCGAGAACACACCCGATGTATTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000783.3-1033s21c1
Sequence:CCGGCTGAAGAGTAAGGGTTTACTTCTCGAGAAGTAAACCCTTACTCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000783.3-1447s21c1
Sequence:CCGGCTAAATGGACCTCCTACAATGCTCGAGCATTGTAGGAGGTCCATTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000783.2-427s1c1
Sequence:CCGGGCAGCGCAAGAAGGTGATTATCTCGAGATAATCACCTTCTTGCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000783.2-238s1c1
Sequence:CCGGGCGCAGGAAATACGGCTTCATCTCGAGATGAAGCCGTATTTCCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000783.2-1483s1c1
Sequence:CCGGCCCTGCAAGATTCACCCATTTCTCGAGAAATGGGTGAATCTTGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000783.2-1013s1c1
Sequence:CCGGCTGAAGAGTAAGGGTTTACTTCTCGAGAAGTAAACCCTTACTCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000783.2-1082s1c1
Sequence:CCGGCTTAAATACATCGGGTGTGTTCTCGAGAACACACCCGATGTATTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000783
VALIDATED
CYP26A1 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 26, subfamily A, polypeptide 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000296285    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000783.3-1657s21c1
Sequence:CCGGACTATACTACCACAATCTTTACTCGAGTAAAGATTGTGGTAGTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000783.3-1503s21c1
Sequence:CCGGCCCTGCAAGATTCACCCATTTCTCGAGAAATGGGTGAATCTTGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000783.3-1102s21c1
Sequence:CCGGCTTAAATACATCGGGTGTGTTCTCGAGAACACACCCGATGTATTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000783.3-1033s21c1
Sequence:CCGGCTGAAGAGTAAGGGTTTACTTCTCGAGAAGTAAACCCTTACTCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000783.3-1447s21c1
Sequence:CCGGCTAAATGGACCTCCTACAATGCTCGAGCATTGTAGGAGGTCCATTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000783.2-427s1c1
Sequence:CCGGGCAGCGCAAGAAGGTGATTATCTCGAGATAATCACCTTCTTGCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000783.2-238s1c1
Sequence:CCGGGCGCAGGAAATACGGCTTCATCTCGAGATGAAGCCGTATTTCCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000783.2-1483s1c1
Sequence:CCGGCCCTGCAAGATTCACCCATTTCTCGAGAAATGGGTGAATCTTGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000783.2-1013s1c1
Sequence:CCGGCTGAAGAGTAAGGGTTTACTTCTCGAGAAGTAAACCCTTACTCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000783.2-1082s1c1
Sequence:CCGGCTTAAATACATCGGGTGTGTTCTCGAGAACACACCCGATGTATTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000783
VALIDATED
CYP26A1 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 26, subfamily A, polypeptide 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000296285    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000783.3-1657s21c1
Sequence:CCGGACTATACTACCACAATCTTTACTCGAGTAAAGATTGTGGTAGTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000783.3-1503s21c1
Sequence:CCGGCCCTGCAAGATTCACCCATTTCTCGAGAAATGGGTGAATCTTGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000783.3-1102s21c1
Sequence:CCGGCTTAAATACATCGGGTGTGTTCTCGAGAACACACCCGATGTATTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000783.3-1033s21c1
Sequence:CCGGCTGAAGAGTAAGGGTTTACTTCTCGAGAAGTAAACCCTTACTCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000783.3-1447s21c1
Sequence:CCGGCTAAATGGACCTCCTACAATGCTCGAGCATTGTAGGAGGTCCATTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000783.2-427s1c1
Sequence:CCGGGCAGCGCAAGAAGGTGATTATCTCGAGATAATCACCTTCTTGCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000783.2-238s1c1
Sequence:CCGGGCGCAGGAAATACGGCTTCATCTCGAGATGAAGCCGTATTTCCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000783.2-1483s1c1
Sequence:CCGGCCCTGCAAGATTCACCCATTTCTCGAGAAATGGGTGAATCTTGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000783.2-1013s1c1
Sequence:CCGGCTGAAGAGTAAGGGTTTACTTCTCGAGAAGTAAACCCTTACTCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000783.2-1082s1c1
Sequence:CCGGCTTAAATACATCGGGTGTGTTCTCGAGAACACACCCGATGTATTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007811
CYP26A1 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 26, subfamily A, polypeptide 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007811.2-1027s21c1
Sequence:CCGGGCGACGTCACTGATCACTTACCTCGAGGTAAGTGATCAGTGACGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007811.2-1342s21c1
Sequence:CCGGTTTAATCCCGACCGCTTTATACTCGAGTATAAAGCGGTCGGGATTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216633    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007811.2-1504s1c1
Sequence:CCGGCTAAATGGACCTCCTACAATGCTCGAGCATTGTAGGAGGTCCATTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250414    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007811.2-1611s21c1
Sequence:CCGGCTTGGACTTATTTGAAGTGTACTCGAGTACACTTCAAATAAGTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007811.2-1586s21c1
Sequence:CCGGGAGATATCTGATAGCTATTTCCTCGAGGAAATAGCTATCAGATATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007811.2-505s21c1
Sequence:CCGGCAGCGAAAGAAGGTGATTATGCTCGAGCATAATCACCTTCTTTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007811.1-458s1c1
Sequence:CCGGGCAGCGAAAGAAGGTGATTATCTCGAGATAATCACCTTCTTTCGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173189    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007811.1-287s1c1
Sequence:CCGGCATCTACAAGACGCATCTGTTCTCGAGAACAGATGCGTCTTGTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007811
CYP26A1 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 26, subfamily A, polypeptide 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007811.2-1027s21c1
Sequence:CCGGGCGACGTCACTGATCACTTACCTCGAGGTAAGTGATCAGTGACGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007811.2-1342s21c1
Sequence:CCGGTTTAATCCCGACCGCTTTATACTCGAGTATAAAGCGGTCGGGATTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216633    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007811.2-1504s1c1
Sequence:CCGGCTAAATGGACCTCCTACAATGCTCGAGCATTGTAGGAGGTCCATTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250414    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007811.2-1611s21c1
Sequence:CCGGCTTGGACTTATTTGAAGTGTACTCGAGTACACTTCAAATAAGTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007811.2-1586s21c1
Sequence:CCGGGAGATATCTGATAGCTATTTCCTCGAGGAAATAGCTATCAGATATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007811.2-505s21c1
Sequence:CCGGCAGCGAAAGAAGGTGATTATGCTCGAGCATAATCACCTTCTTTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007811.1-458s1c1
Sequence:CCGGGCAGCGAAAGAAGGTGATTATCTCGAGATAATCACCTTCTTTCGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173189    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007811.1-287s1c1
Sequence:CCGGCATCTACAAGACGCATCTGTTCTCGAGAACAGATGCGTCTTGTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007811
CYP26A1 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 26, subfamily A, polypeptide 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007811.2-1027s21c1
Sequence:CCGGGCGACGTCACTGATCACTTACCTCGAGGTAAGTGATCAGTGACGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007811.2-1342s21c1
Sequence:CCGGTTTAATCCCGACCGCTTTATACTCGAGTATAAAGCGGTCGGGATTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216633    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007811.2-1504s1c1
Sequence:CCGGCTAAATGGACCTCCTACAATGCTCGAGCATTGTAGGAGGTCCATTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250414    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007811.2-1611s21c1
Sequence:CCGGCTTGGACTTATTTGAAGTGTACTCGAGTACACTTCAAATAAGTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007811.2-1586s21c1
Sequence:CCGGGAGATATCTGATAGCTATTTCCTCGAGGAAATAGCTATCAGATATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007811.2-505s21c1
Sequence:CCGGCAGCGAAAGAAGGTGATTATGCTCGAGCATAATCACCTTCTTTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007811.1-458s1c1
Sequence:CCGGGCAGCGAAAGAAGGTGATTATCTCGAGATAATCACCTTCTTTCGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173189    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007811.1-287s1c1
Sequence:CCGGCATCTACAAGACGCATCTGTTCTCGAGAACAGATGCGTCTTGTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks