EMAIL THIS PAGE TO A FRIEND

CYP26B1

cytochrome P450, family 26, subfamily B, polypeptide 1

130 Gene Product Result for
Synonyms: CYP26A2 P450RAI-2 P450RAI2 RHFCA
Gene ID:
Human(56603) Summary: This gene encodes a member of the cytochrome P450 superfamily. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. The encoded protein is localized to the endoplasmic reticulum, and functions as a critical regulator of all-trans retinoic acid levels by the specific inactivation of all-trans retinoic acid to hydroxylated forms. Mutations in this gene are associated with radiohumeral fusions and other skeletal and craniofacial anomalies, and increased levels of the encoded protein are associated with atherosclerotic lesions. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2013]
Mouse(232174) cytochrome P450, family 26, subfamily b, polypeptide 1
Rat(312495) cytochrome P450, family 26, subfamily b, polypeptide 1
Zebrafish(324188) cytochrome P450, family 26, subfamily b, polypeptide 1
chicken(428809) cytochrome P450, family 26, subfamily B, polypeptide 1
cow(540868) cytochrome P450, family 26, subfamily B, polypeptide 1
dog(483120) cytochrome P450, family 26, subfamily B, polypeptide 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019885 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019885 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019885 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175475 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175475 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175475 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019885 Rosetta Predictions human pricing
NM_181087 Rosetta Predictions rat pricing
NM_175475 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019885 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117508 predicted 1135
2 SASI_Hs01_00117509 predicted 407
3 SASI_Hs01_00117510 predicted 234
4 SASI_Hs02_00352897 predicted 1822
5 SASI_Hs01_00117511 predicted 871
6 SASI_Hs01_00117512 predicted 965
7 SASI_Hs01_00117513 predicted 1267
8 SASI_Hs01_00117514 predicted 1455
9 SASI_Hs01_00117515 predicted 1191
10 SASI_Hs01_00117516 predicted 552
11 SASI_Hs01_00117517 predicted 616
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181087 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057918 predicted 1268
2 SASI_Rn01_00057919 predicted 1567
3 SASI_Rn01_00057920 predicted 1680
4 SASI_Rn01_00057921 predicted 564
5 SASI_Rn02_00269669 predicted 1558
6 SASI_Rn01_00057922 predicted 384
7 SASI_Rn01_00057923 predicted 1070
8 SASI_Rn01_00057924 predicted 685
9 SASI_Rn01_00057925 predicted 339
10 SASI_Rn01_00057926 predicted 921
11 SASI_Rn01_00057927 predicted 326
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175475 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053262 predicted 582
2 SASI_Mm01_00053263 predicted 1820
3 SASI_Mm01_00053264 predicted 706
4 SASI_Mm02_00346387 predicted 1207
5 SASI_Mm01_00053265 predicted 523
6 SASI_Mm01_00053266 predicted 650
7 SASI_Mm01_00053267 predicted 1752
8 SASI_Mm01_00053268 predicted 771
9 SASI_Mm01_00053269 predicted 469
10 SASI_Mm01_00053271 predicted 1502
11 SASI_Mm01_00053270 predicted 721
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019885
CYP26B1 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 26, subfamily B, polypeptide 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019885.2-242s1c1
Sequence:CCGGGCAACGTGTTCAAGACGCATTCTCGAGAATGCGTCTTGAACACGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019885.2-1137s1c1
Sequence:CCGGCGAGCTTGATGGTTTCCAGATCTCGAGATCTGGAAACCATCAAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019885.2-630s1c1
Sequence:CCGGCTTTGAGGTCTACCAGCAGTTCTCGAGAACTGCTGGTAGACCTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019885.2-874s1c1
Sequence:CCGGGAGCTGATCTTTGCGGCCTATCTCGAGATAGGCCGCAAAGATCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019885.2-390s1c1
Sequence:CCGGGTCCAATTCCATTGGCGACATCTCGAGATGTCGCCAATGGAATTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019885.2-1454s21c1
Sequence:CCGGGCCTCAGCGTCAAGTTCTTTGCTCGAGCAAAGAACTTGACGCTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019885.2-1217s21c1
Sequence:CCGGTCAAAGACGTGAACGTGTTCGCTCGAGCGAACACGTTCACGTCTTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019885.2-428s21c1
Sequence:CCGGAGGTCTTCTCCAAGATCTTCACTCGAGTGAAGATCTTGGAGAAGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019885
CYP26B1 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 26, subfamily B, polypeptide 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019885.2-242s1c1
Sequence:CCGGGCAACGTGTTCAAGACGCATTCTCGAGAATGCGTCTTGAACACGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019885.2-1137s1c1
Sequence:CCGGCGAGCTTGATGGTTTCCAGATCTCGAGATCTGGAAACCATCAAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019885.2-630s1c1
Sequence:CCGGCTTTGAGGTCTACCAGCAGTTCTCGAGAACTGCTGGTAGACCTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019885.2-874s1c1
Sequence:CCGGGAGCTGATCTTTGCGGCCTATCTCGAGATAGGCCGCAAAGATCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019885.2-390s1c1
Sequence:CCGGGTCCAATTCCATTGGCGACATCTCGAGATGTCGCCAATGGAATTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019885.2-1454s21c1
Sequence:CCGGGCCTCAGCGTCAAGTTCTTTGCTCGAGCAAAGAACTTGACGCTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019885.2-1217s21c1
Sequence:CCGGTCAAAGACGTGAACGTGTTCGCTCGAGCGAACACGTTCACGTCTTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019885.2-428s21c1
Sequence:CCGGAGGTCTTCTCCAAGATCTTCACTCGAGTGAAGATCTTGGAGAAGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019885
CYP26B1 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 26, subfamily B, polypeptide 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019885.2-242s1c1
Sequence:CCGGGCAACGTGTTCAAGACGCATTCTCGAGAATGCGTCTTGAACACGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019885.2-1137s1c1
Sequence:CCGGCGAGCTTGATGGTTTCCAGATCTCGAGATCTGGAAACCATCAAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019885.2-630s1c1
Sequence:CCGGCTTTGAGGTCTACCAGCAGTTCTCGAGAACTGCTGGTAGACCTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019885.2-874s1c1
Sequence:CCGGGAGCTGATCTTTGCGGCCTATCTCGAGATAGGCCGCAAAGATCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019885.2-390s1c1
Sequence:CCGGGTCCAATTCCATTGGCGACATCTCGAGATGTCGCCAATGGAATTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019885.2-1454s21c1
Sequence:CCGGGCCTCAGCGTCAAGTTCTTTGCTCGAGCAAAGAACTTGACGCTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019885.2-1217s21c1
Sequence:CCGGTCAAAGACGTGAACGTGTTCGCTCGAGCGAACACGTTCACGTCTTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019885.2-428s21c1
Sequence:CCGGAGGTCTTCTCCAAGATCTTCACTCGAGTGAAGATCTTGGAGAAGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175475
CYP26B1 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 26, subfamily B, polypeptide 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174407    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175475.2-3608s1c1
Sequence:CCGGCCAGAACAAACTACAGCATTACTCGAGTAATGCTGTAGTTTGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173956    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175475.2-1426s1c1
Sequence:CCGGGACCTTCGAACTGGATGGTTTCTCGAGAAACCATCCAGTTCGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173854    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175475.2-1813s1c1
Sequence:CCGGCATGTTGAGTGCTACGGTGTACTCGAGTACACCGTAGCACTCAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174048    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175475.2-1507s1c1
Sequence:CCGGCGTGTTCAAGGACGTGAATGTCTCGAGACATTCACGTCCTTGAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173771    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175475.2-688s1c1
Sequence:CCGGCAATTCCATTGGCGACATCCACTCGAGTGGATGTCGCCAATGGAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175475.2-919s1c1
Sequence:CCGGCCACCTCTTTGAGGTATACCACTCGAGTGGTATACCTCAAAGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175475.2-1216s21c1
Sequence:CCGGCTTGATCATGCAACTGCTAAACTCGAGTTTAGCAGTTGCATGATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175475.2-916s21c1
Sequence:CCGGGGGCCACCTCTTTGAGGTATACTCGAGTATACCTCAAAGAGGTGGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175475.2-820s21c1
Sequence:CCGGGCCTGAGGCCATCAATGTATACTCGAGTATACATTGATGGCCTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246360    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175475.2-3359s21c1
Sequence:CCGGTGGTGTGTCTCTAGGCAATTTCTCGAGAAATTGCCTAGAGACACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175475.2-1506s21c1
Sequence:CCGGCCGTGTTCAAGGACGTGAATGCTCGAGCATTCACGTCCTTGAACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175475
CYP26B1 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 26, subfamily B, polypeptide 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174407    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175475.2-3608s1c1
Sequence:CCGGCCAGAACAAACTACAGCATTACTCGAGTAATGCTGTAGTTTGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173956    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175475.2-1426s1c1
Sequence:CCGGGACCTTCGAACTGGATGGTTTCTCGAGAAACCATCCAGTTCGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173854    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175475.2-1813s1c1
Sequence:CCGGCATGTTGAGTGCTACGGTGTACTCGAGTACACCGTAGCACTCAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174048    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175475.2-1507s1c1
Sequence:CCGGCGTGTTCAAGGACGTGAATGTCTCGAGACATTCACGTCCTTGAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173771    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175475.2-688s1c1
Sequence:CCGGCAATTCCATTGGCGACATCCACTCGAGTGGATGTCGCCAATGGAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175475.2-919s1c1
Sequence:CCGGCCACCTCTTTGAGGTATACCACTCGAGTGGTATACCTCAAAGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175475.2-1216s21c1
Sequence:CCGGCTTGATCATGCAACTGCTAAACTCGAGTTTAGCAGTTGCATGATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175475.2-916s21c1
Sequence:CCGGGGGCCACCTCTTTGAGGTATACTCGAGTATACCTCAAAGAGGTGGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175475.2-820s21c1
Sequence:CCGGGCCTGAGGCCATCAATGTATACTCGAGTATACATTGATGGCCTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246360    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175475.2-3359s21c1
Sequence:CCGGTGGTGTGTCTCTAGGCAATTTCTCGAGAAATTGCCTAGAGACACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175475.2-1506s21c1
Sequence:CCGGCCGTGTTCAAGGACGTGAATGCTCGAGCATTCACGTCCTTGAACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175475
CYP26B1 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 26, subfamily B, polypeptide 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174407    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175475.2-3608s1c1
Sequence:CCGGCCAGAACAAACTACAGCATTACTCGAGTAATGCTGTAGTTTGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173956    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175475.2-1426s1c1
Sequence:CCGGGACCTTCGAACTGGATGGTTTCTCGAGAAACCATCCAGTTCGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173854    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175475.2-1813s1c1
Sequence:CCGGCATGTTGAGTGCTACGGTGTACTCGAGTACACCGTAGCACTCAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174048    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175475.2-1507s1c1
Sequence:CCGGCGTGTTCAAGGACGTGAATGTCTCGAGACATTCACGTCCTTGAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173771    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175475.2-688s1c1
Sequence:CCGGCAATTCCATTGGCGACATCCACTCGAGTGGATGTCGCCAATGGAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175475.2-919s1c1
Sequence:CCGGCCACCTCTTTGAGGTATACCACTCGAGTGGTATACCTCAAAGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175475.2-1216s21c1
Sequence:CCGGCTTGATCATGCAACTGCTAAACTCGAGTTTAGCAGTTGCATGATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175475.2-916s21c1
Sequence:CCGGGGGCCACCTCTTTGAGGTATACTCGAGTATACCTCAAAGAGGTGGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175475.2-820s21c1
Sequence:CCGGGCCTGAGGCCATCAATGTATACTCGAGTATACATTGATGGCCTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246360    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175475.2-3359s21c1
Sequence:CCGGTGGTGTGTCTCTAGGCAATTTCTCGAGAAATTGCCTAGAGACACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175475.2-1506s21c1
Sequence:CCGGCCGTGTTCAAGGACGTGAATGCTCGAGCATTCACGTCCTTGAACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks