EMAIL THIS PAGE TO A FRIEND

CYP26C1

cytochrome P450, family 26, subfamily C, polypeptide 1

51 Gene Product Result for
Synonyms: FFDD4
UniProtKB ID: Q6V0L0, Q5VXH6
Gene ID:
Human(340665) Summary: This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This enzyme is involved in the catabolism of all-trans- and 9-cis-retinoic acid, and thus contributes to the regulation of retinoic acid levels in cells and tissues. This gene is adjacent to a related gene on chromosome 10q23.33. [provided by RefSeq, Jul 2008]
Mouse(546726) cytochrome P450, family 26, subfamily c, polypeptide 1
Rat(308190) cytochrome P450, family 26, subfamily C, polypeptide 1
Zebrafish(554036) cytochrome P450, family 26, subfamily C, polypeptide 1
cow(539048) cytochrome P450, family 26, subfamily C, polypeptide 1
dog(608216) cytochrome P450, family 26, subfamily C, polypeptide 1
chicken(423806) cytochrome P450, family 26, subfamily C, polypeptide 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183374 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_183374 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_183374 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001105201 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001105201 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001105201 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_183374 Rosetta Predictions human pricing
XM_001080197 Rosetta Predictions rat pricing
XM_217935 Rosetta Predictions rat pricing
NM_001105201 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183374 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217063 predicted 294
2 SASI_Hs01_00217064 predicted 683
3 SASI_Hs01_00217065 predicted 233
4 SASI_Hs01_00217066 predicted 488
5 SASI_Hs01_00217067 predicted 664
6 SASI_Hs01_00217068 predicted 235
7 SASI_Hs01_00217069 predicted 229
8 SASI_Hs01_00217070 predicted 204
9 SASI_Hs01_00217071 predicted 358
10 SASI_Hs01_00217072 predicted 637
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080197 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00367008 predicted 537
2 SASI_Rn02_00367009 predicted 1073
3 SASI_Rn02_00367010 predicted 290
4 SASI_Rn02_00367011 predicted 459
5 SASI_Rn02_00367012 predicted 1144
6 SASI_Rn02_00367013 predicted 522
7 SASI_Rn02_00367014 predicted 1311
8 SASI_Rn02_00367015 predicted 359
9 SASI_Rn02_00367016 predicted 353
10 SASI_Rn02_00367017 predicted 684
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_217935 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00377407 predicted 534
2 SASI_Rn02_00377408 predicted 1072
3 SASI_Rn02_00377409 predicted 286
4 SASI_Rn02_00377410 predicted 460
5 SASI_Rn02_00377411 predicted 1150
6 SASI_Rn02_00377412 predicted 516
7 SASI_Rn02_00377413 predicted 1306
8 SASI_Rn02_00377414 predicted 350
9 SASI_Rn02_00377415 predicted 351
10 SASI_Rn02_00377416 predicted 682
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105201 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00303955 predicted 536
2 SASI_Mm02_00303956 predicted 286
3 SASI_Mm02_00303957 predicted 1164
4 SASI_Mm02_00303958 predicted 678
5 SASI_Mm02_00303959 predicted 1073
6 SASI_Mm02_00303960 predicted 343
7 SASI_Mm02_00303961 predicted 382
8 SASI_Mm02_00303962 predicted 781
9 SASI_Mm02_00303963 predicted 1263
10 SASI_Mm02_00303964 predicted 656
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183374
CYP26C1 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 26, subfamily C, polypeptide 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183374.2-231s21c1
Sequence:CCGGAGAGCGCTATGGGACAGTGTTCTCGAGAACACTGTCCCATAGCGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183374.2-748s21c1
Sequence:CCGGGCCATTTCTGAGAAGCTTCACCTCGAGGTGAAGCTTCTCAGAAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183374.2-1101s21c1
Sequence:CCGGCTACGTCGACTGCGTGGTCAACTCGAGTTGACCACGCAGTCGACGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183374.2-1272s21c1
Sequence:CCGGTCCCGAAGGCTTCGATCCAGACTCGAGTCTGGATCGAAGCCTTCGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183374.1-803s1c1
Sequence:CCGGACCTAATCATTCACAGTGCAACTCGAGTTGCACTGTGAATGATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183374.1-538s1c1
Sequence:CCGGTCAGTCTACGACGCCTCCAAACTCGAGTTTGGAGGCGTCGTAGACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183374.1-1408s1c1
Sequence:CCGGCAGCTGCTAGCTGTGGAGCTACTCGAGTAGCTCCACAGCTAGCAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183374.1-793s1c1
Sequence:CCGGGATGCCCTCGACCTAATCATTCTCGAGAATGATTAGGTCGAGGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183374.1-181s1c1
Sequence:CCGGGAAACGCTGCACTGGTTAGTTCTCGAGAACTAACCAGTGCAGCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183374
CYP26C1 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 26, subfamily C, polypeptide 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183374.2-231s21c1
Sequence:CCGGAGAGCGCTATGGGACAGTGTTCTCGAGAACACTGTCCCATAGCGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183374.2-748s21c1
Sequence:CCGGGCCATTTCTGAGAAGCTTCACCTCGAGGTGAAGCTTCTCAGAAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183374.2-1101s21c1
Sequence:CCGGCTACGTCGACTGCGTGGTCAACTCGAGTTGACCACGCAGTCGACGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183374.2-1272s21c1
Sequence:CCGGTCCCGAAGGCTTCGATCCAGACTCGAGTCTGGATCGAAGCCTTCGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183374.1-803s1c1
Sequence:CCGGACCTAATCATTCACAGTGCAACTCGAGTTGCACTGTGAATGATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183374.1-538s1c1
Sequence:CCGGTCAGTCTACGACGCCTCCAAACTCGAGTTTGGAGGCGTCGTAGACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183374.1-1408s1c1
Sequence:CCGGCAGCTGCTAGCTGTGGAGCTACTCGAGTAGCTCCACAGCTAGCAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183374.1-793s1c1
Sequence:CCGGGATGCCCTCGACCTAATCATTCTCGAGAATGATTAGGTCGAGGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183374.1-181s1c1
Sequence:CCGGGAAACGCTGCACTGGTTAGTTCTCGAGAACTAACCAGTGCAGCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183374
CYP26C1 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 26, subfamily C, polypeptide 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183374.2-231s21c1
Sequence:CCGGAGAGCGCTATGGGACAGTGTTCTCGAGAACACTGTCCCATAGCGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183374.2-748s21c1
Sequence:CCGGGCCATTTCTGAGAAGCTTCACCTCGAGGTGAAGCTTCTCAGAAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183374.2-1101s21c1
Sequence:CCGGCTACGTCGACTGCGTGGTCAACTCGAGTTGACCACGCAGTCGACGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183374.2-1272s21c1
Sequence:CCGGTCCCGAAGGCTTCGATCCAGACTCGAGTCTGGATCGAAGCCTTCGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183374.1-803s1c1
Sequence:CCGGACCTAATCATTCACAGTGCAACTCGAGTTGCACTGTGAATGATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183374.1-538s1c1
Sequence:CCGGTCAGTCTACGACGCCTCCAAACTCGAGTTTGGAGGCGTCGTAGACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183374.1-1408s1c1
Sequence:CCGGCAGCTGCTAGCTGTGGAGCTACTCGAGTAGCTCCACAGCTAGCAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183374.1-793s1c1
Sequence:CCGGGATGCCCTCGACCTAATCATTCTCGAGAATGATTAGGTCGAGGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183374.1-181s1c1
Sequence:CCGGGAAACGCTGCACTGGTTAGTTCTCGAGAACTAACCAGTGCAGCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001105201
CYP26C1 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 26, subfamily C, polypeptide 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105201.1-349s21c1
Sequence:CCGGTGGCCACAGAGTGCGCATATTCTCGAGAATATGCGCACTCTGTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105201.1-793s21c1
Sequence:CCGGGATGCCCTGCTCTTGATTATTCTCGAGAATAATCAAGAGCAGGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105201.1-165s21c1
Sequence:CCGGCTGGCCATTCTTCGGTGAAACCTCGAGGTTTCACCGAAGAATGGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105201.1-1165s21c1
Sequence:CCGGACCTTTGAACTGGACGGTTACCTCGAGGTAACCGTCCAGTTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105201.1-1197s21c1
Sequence:CCGGAGGCTGGAGCGTGATGTATAGCTCGAGCTATACATCACGCTCCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001105201
CYP26C1 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 26, subfamily C, polypeptide 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105201.1-349s21c1
Sequence:CCGGTGGCCACAGAGTGCGCATATTCTCGAGAATATGCGCACTCTGTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105201.1-793s21c1
Sequence:CCGGGATGCCCTGCTCTTGATTATTCTCGAGAATAATCAAGAGCAGGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105201.1-165s21c1
Sequence:CCGGCTGGCCATTCTTCGGTGAAACCTCGAGGTTTCACCGAAGAATGGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105201.1-1165s21c1
Sequence:CCGGACCTTTGAACTGGACGGTTACCTCGAGGTAACCGTCCAGTTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105201.1-1197s21c1
Sequence:CCGGAGGCTGGAGCGTGATGTATAGCTCGAGCTATACATCACGCTCCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001105201
CYP26C1 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 26, subfamily C, polypeptide 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105201.1-349s21c1
Sequence:CCGGTGGCCACAGAGTGCGCATATTCTCGAGAATATGCGCACTCTGTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105201.1-793s21c1
Sequence:CCGGGATGCCCTGCTCTTGATTATTCTCGAGAATAATCAAGAGCAGGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105201.1-165s21c1
Sequence:CCGGCTGGCCATTCTTCGGTGAAACCTCGAGGTTTCACCGAAGAATGGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105201.1-1165s21c1
Sequence:CCGGACCTTTGAACTGGACGGTTACCTCGAGGTAACCGTCCAGTTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105201.1-1197s21c1
Sequence:CCGGAGGCTGGAGCGTGATGTATAGCTCGAGCTATACATCACGCTCCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks