EMAIL THIS PAGE TO A FRIEND

CYP27A1

cytochrome P450, family 27, subfamily A, polypeptide 1

66 Gene Product Result for
Synonyms: CP27 CTX CYP27
UniProtKB ID: Q02318, A8K303, Q6LDB4, Q86YQ6
Gene ID:
Human(1593) Summary: This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This mitochondrial protein oxidizes cholesterol intermediates as part of the bile synthesis pathway. Since the conversion of cholesterol to bile acids is the major route for removing cholesterol from the body, this protein is important for overall cholesterol homeostasis. Mutations in this gene cause cerebrotendinous xanthomatosis, a rare autosomal recessive lipid storage disease. [provided by RefSeq, Jul 2008]
Mouse(104086) cytochrome P450, family 27, subfamily a, polypeptide 1
Rat(301517) cytochrome P450, family 27, subfamily a, polypeptide 1
chicken(431683) cytochrome P450, family 27, subfamily A, polypeptide 1
dog(610489) cytochrome P450, family 27, subfamily A, polypeptide 1
cow(511960) cytochrome P450, family 27, subfamily A, polypeptide 1
Domestic Rabbit(100348736) sterol 26-hydroxylase, mitochondrial
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000784 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000784 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000784 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024264 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024264 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024264 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU003991 MISSION® esiRNA esiRNA targeting human CYP27A1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000784 Rosetta Predictions human pricing
NM_178847 Rosetta Predictions rat pricing
XM_579715 Rosetta Predictions rat pricing
NM_024264 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000784 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203534 predicted 1627
2 SASI_Hs01_00203535 predicted 708
3 SASI_Hs02_00303224 predicted 1165
4 SASI_Hs02_00303225 predicted 793
5 SASI_Hs01_00203536 predicted 968
6 SASI_Hs01_00203537 predicted 678
7 SASI_Hs01_00203538 predicted 948
8 SASI_Hs01_00203539 predicted 1054
9 SASI_Hs01_00203540 predicted 599
10 SASI_Hs01_00203542 predicted 1636
11 SASI_Hs01_00203541 predicted 563
12 SASI_Hs01_00203543 predicted 1339
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178847 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061032 predicted 853
2 SASI_Rn01_00061033 predicted 987
3 SASI_Rn02_00269647 predicted 885
4 SASI_Rn01_00061034 predicted 1305
5 SASI_Rn02_00269648 predicted 1083
6 SASI_Rn01_00061037 predicted 1403
7 SASI_Rn01_00061038 predicted 789
8 SASI_Rn01_00061040 predicted 315
9 SASI_Rn01_00061041 predicted 268
10 SASI_Rn02_00269649 predicted 995
11 SASI_Rn01_00061035 predicted 664
12 SASI_Rn01_00061036 predicted 1064
13 SASI_Rn01_00061039 predicted 1460
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579715 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00181360 predicted 1101
2 SASI_Rn01_00181361 predicted 1201
3 SASI_Rn01_00181362 predicted 1004
4 SASI_Rn01_00181363 predicted 1139
5 SASI_Rn01_00181364 predicted 379
6 SASI_Rn01_00181365 predicted 383
7 SASI_Rn01_00181366 predicted 1133
8 SASI_Rn01_00181367 predicted 1052
9 SASI_Rn01_00181368 predicted 1174
10 SASI_Rn01_00181369 predicted 421
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024264 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115845 predicted 1532
2 SASI_Mm01_00115846 predicted 424
3 SASI_Mm01_00115847 predicted 269
4 SASI_Mm01_00115848 predicted 1327
5 SASI_Mm01_00115849 predicted 585
6 SASI_Mm02_00327666 predicted 806
7 SASI_Mm01_00115850 predicted 870
8 SASI_Mm01_00115851 predicted 901
9 SASI_Mm01_00115853 predicted 598
10 SASI_Mm01_00115854 predicted 1002
11 SASI_Mm01_00115852 predicted 675
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000784
CYP27A1 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 27, subfamily A, polypeptide 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000784.2-730s1c1
Sequence:CCGGGCTTTCAATGAGGTGATTGATCTCGAGATCAATCACCTCATTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000784.2-444s1c1
Sequence:CCGGGCACCAGTTACAGGTGCTTTACTCGAGTAAAGCACCTGTAACTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000784.2-1009s1c1
Sequence:CCGGCGATACCTGGATGGTTGGAATCTCGAGATTCCAACCATCCAGGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000784.2-1738s1c1
Sequence:CCGGCGCATTGTCCTGGTTCCCAATCTCGAGATTGGGAACCAGGACAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000784.2-1468s1c1
Sequence:CCGGCAGTTTGTGTTCTGCCACTATCTCGAGATAGTGGCAGAACACAAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231147    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000784.3-2202s21c1
Sequence:CCGGAGCAACTCCCTCTCAGCTAAACTCGAGTTTAGCTGAGAGGGAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000784.3-1153s21c1
Sequence:CCGGTCGTCAGATCCATCGGGTTAACTCGAGTTAACCCGATGGATCTGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000784.3-1066s21c1
Sequence:GTACCGGACTTTGCCTTGGAAGCTATTTCTCGAGAAATAGCTTCCAAGGCAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000784.3-715s21c1
Sequence:CCGGCAATGTGGATGTCCTACTTAGCTCGAGCTAAGTAGGACATCCACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000784.3-1636s21c1
Sequence:CCGGCCACAAACTCCCGGATCATAGCTCGAGCTATGATCCGGGAGTTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000784
CYP27A1 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 27, subfamily A, polypeptide 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000784.2-730s1c1
Sequence:CCGGGCTTTCAATGAGGTGATTGATCTCGAGATCAATCACCTCATTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000784.2-444s1c1
Sequence:CCGGGCACCAGTTACAGGTGCTTTACTCGAGTAAAGCACCTGTAACTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000784.2-1009s1c1
Sequence:CCGGCGATACCTGGATGGTTGGAATCTCGAGATTCCAACCATCCAGGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000784.2-1738s1c1
Sequence:CCGGCGCATTGTCCTGGTTCCCAATCTCGAGATTGGGAACCAGGACAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000784.2-1468s1c1
Sequence:CCGGCAGTTTGTGTTCTGCCACTATCTCGAGATAGTGGCAGAACACAAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231147    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000784.3-2202s21c1
Sequence:CCGGAGCAACTCCCTCTCAGCTAAACTCGAGTTTAGCTGAGAGGGAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000784.3-1153s21c1
Sequence:CCGGTCGTCAGATCCATCGGGTTAACTCGAGTTAACCCGATGGATCTGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000784.3-1066s21c1
Sequence:GTACCGGACTTTGCCTTGGAAGCTATTTCTCGAGAAATAGCTTCCAAGGCAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000784.3-715s21c1
Sequence:CCGGCAATGTGGATGTCCTACTTAGCTCGAGCTAAGTAGGACATCCACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000784.3-1636s21c1
Sequence:CCGGCCACAAACTCCCGGATCATAGCTCGAGCTATGATCCGGGAGTTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000784
CYP27A1 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 27, subfamily A, polypeptide 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000784.2-730s1c1
Sequence:CCGGGCTTTCAATGAGGTGATTGATCTCGAGATCAATCACCTCATTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000784.2-444s1c1
Sequence:CCGGGCACCAGTTACAGGTGCTTTACTCGAGTAAAGCACCTGTAACTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000784.2-1009s1c1
Sequence:CCGGCGATACCTGGATGGTTGGAATCTCGAGATTCCAACCATCCAGGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000784.2-1738s1c1
Sequence:CCGGCGCATTGTCCTGGTTCCCAATCTCGAGATTGGGAACCAGGACAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000784.2-1468s1c1
Sequence:CCGGCAGTTTGTGTTCTGCCACTATCTCGAGATAGTGGCAGAACACAAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231147    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000784.3-2202s21c1
Sequence:CCGGAGCAACTCCCTCTCAGCTAAACTCGAGTTTAGCTGAGAGGGAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000784.3-1153s21c1
Sequence:CCGGTCGTCAGATCCATCGGGTTAACTCGAGTTAACCCGATGGATCTGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000784.3-1066s21c1
Sequence:GTACCGGACTTTGCCTTGGAAGCTATTTCTCGAGAAATAGCTTCCAAGGCAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000784.3-715s21c1
Sequence:CCGGCAATGTGGATGTCCTACTTAGCTCGAGCTAAGTAGGACATCCACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000784.3-1636s21c1
Sequence:CCGGCCACAAACTCCCGGATCATAGCTCGAGCTATGATCCGGGAGTTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024264
CYP27A1 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 27, subfamily A, polypeptide 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024264.3-328s1c1
Sequence:CCGGCAAGACCAAGTATGGTCCAATCTCGAGATTGGACCATACTTGGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176159    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024264.3-1417s1c1
Sequence:CCGGGAGGAAGAAAGAGGCTGATAACTCGAGTTATCAGCCTCTTTCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024264.3-274s1c1
Sequence:CCGGCCAGCTATTTCTACAAGGCTACTCGAGTAGCCTTGTAGAAATAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024264.3-1323s1c1
Sequence:CCGGCCAAGAATACACAGTTTGTGTCTCGAGACACAAACTGTGTATTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024264.3-1543s1c1
Sequence:CCGGGCTGGTACAGAAGTATGAGATCTCGAGATCTCATACTTCTGTACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024264.3-588s1c1
Sequence:CCGGCGGATGCCTTAAACGAGGTTACTCGAGTAACCTCGTTTAAGGCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024264.4-273s21c1
Sequence:CCGGCCAGCTATTTCTACAAGGCTACTCGAGTAGCCTTGTAGAAATAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024264.4-710s1c1
Sequence:CCGGCCATCACCTATATCCTGTTTGCTCGAGCAAACAGGATATAGGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024264.4-1322s21c1
Sequence:CCGGCCAAGAATACACAGTTTGTGTCTCGAGACACAAACTGTGTATTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024264.4-1542s21c1
Sequence:CCGGGCTGGTACAGAAGTATGAGATCTCGAGATCTCATACTTCTGTACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024264.4-587s21c1
Sequence:CCGGCGGATGCCTTAAACGAGGTTACTCGAGTAACCTCGTTTAAGGCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024264
CYP27A1 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 27, subfamily A, polypeptide 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024264.3-328s1c1
Sequence:CCGGCAAGACCAAGTATGGTCCAATCTCGAGATTGGACCATACTTGGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176159    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024264.3-1417s1c1
Sequence:CCGGGAGGAAGAAAGAGGCTGATAACTCGAGTTATCAGCCTCTTTCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024264.3-274s1c1
Sequence:CCGGCCAGCTATTTCTACAAGGCTACTCGAGTAGCCTTGTAGAAATAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024264.3-1323s1c1
Sequence:CCGGCCAAGAATACACAGTTTGTGTCTCGAGACACAAACTGTGTATTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024264.3-1543s1c1
Sequence:CCGGGCTGGTACAGAAGTATGAGATCTCGAGATCTCATACTTCTGTACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024264.3-588s1c1
Sequence:CCGGCGGATGCCTTAAACGAGGTTACTCGAGTAACCTCGTTTAAGGCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024264.4-273s21c1
Sequence:CCGGCCAGCTATTTCTACAAGGCTACTCGAGTAGCCTTGTAGAAATAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024264.4-710s1c1
Sequence:CCGGCCATCACCTATATCCTGTTTGCTCGAGCAAACAGGATATAGGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024264.4-1322s21c1
Sequence:CCGGCCAAGAATACACAGTTTGTGTCTCGAGACACAAACTGTGTATTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024264.4-1542s21c1
Sequence:CCGGGCTGGTACAGAAGTATGAGATCTCGAGATCTCATACTTCTGTACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024264.4-587s21c1
Sequence:CCGGCGGATGCCTTAAACGAGGTTACTCGAGTAACCTCGTTTAAGGCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024264
CYP27A1 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 27, subfamily A, polypeptide 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024264.3-328s1c1
Sequence:CCGGCAAGACCAAGTATGGTCCAATCTCGAGATTGGACCATACTTGGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176159    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024264.3-1417s1c1
Sequence:CCGGGAGGAAGAAAGAGGCTGATAACTCGAGTTATCAGCCTCTTTCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024264.3-274s1c1
Sequence:CCGGCCAGCTATTTCTACAAGGCTACTCGAGTAGCCTTGTAGAAATAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024264.3-1323s1c1
Sequence:CCGGCCAAGAATACACAGTTTGTGTCTCGAGACACAAACTGTGTATTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024264.3-1543s1c1
Sequence:CCGGGCTGGTACAGAAGTATGAGATCTCGAGATCTCATACTTCTGTACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024264.3-588s1c1
Sequence:CCGGCGGATGCCTTAAACGAGGTTACTCGAGTAACCTCGTTTAAGGCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024264.4-273s21c1
Sequence:CCGGCCAGCTATTTCTACAAGGCTACTCGAGTAGCCTTGTAGAAATAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024264.4-710s1c1
Sequence:CCGGCCATCACCTATATCCTGTTTGCTCGAGCAAACAGGATATAGGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024264.4-1322s21c1
Sequence:CCGGCCAAGAATACACAGTTTGTGTCTCGAGACACAAACTGTGTATTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024264.4-1542s21c1
Sequence:CCGGGCTGGTACAGAAGTATGAGATCTCGAGATCTCATACTTCTGTACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024264.4-587s21c1
Sequence:CCGGCGGATGCCTTAAACGAGGTTACTCGAGTAACCTCGTTTAAGGCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks