EMAIL THIS PAGE TO A FRIEND

CYP27B1

cytochrome P450, family 27, subfamily B, polypeptide 1

88 Gene Product Result for
Synonyms: CP2B CYP1 CYP1alpha CYP27B P450c1 PDDR VDD1 VDDR VDDRI VDR
UniProtKB ID: O15528
Gene ID:
Human(1594) Summary: This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. The protein encoded by this gene localizes to the inner mitochondrial membrane where it hydroxylates 25-hydroxyvitamin D3 at the 1alpha position. This reaction synthesizes 1alpha,25-dihydroxyvitamin D3, the active form of vitamin D3, which binds to the vitamin D receptor and regulates calcium metabolism. Thus this enzyme regulates the level of biologically active vitamin D and plays an important role in calcium homeostasis. Mutations in this gene can result in vitamin D-dependent rickets type I. [provided by RefSeq, Jul 2008]
Mouse(13115) cytochrome P450, family 27, subfamily b, polypeptide 1
Rat(114700) cytochrome P450, family 27, subfamily b, polypeptide 1
domestic cat(100750221) cytochrome P450, family 27, subfamily B, polypeptide 1
dog(481133) cytochrome P450, family 27, subfamily B, polypeptide 1
Horse(100034100) cytochrome P450, family 27, subfamily B, polypeptide 1
cow(539630) cytochrome P450, family 27, subfamily B, polypeptide 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301259 ANTI-CYP27B1 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing
SAB1301594 ANTI-CYP27B1 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000785 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000785 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000785 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010009 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010009 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010009 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU004761 MISSION® esiRNA esiRNA targeting human CYP27B1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000785 Rosetta Predictions human pricing
NM_053763 Rosetta Predictions rat pricing
NM_010009 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000785 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037670 predicted 1329
2 SASI_Hs02_00303226 predicted 1997
3 SASI_Hs01_00037672 predicted 1328
4 SASI_Hs01_00037673 predicted 2011
5 SASI_Hs01_00037674 predicted 2159
6 SASI_Hs01_00037675 predicted 2020
7 SASI_Hs01_00037676 predicted 1976
8 SASI_Hs01_00037677 predicted 1792
9 SASI_Hs02_00303227 predicted 2094
10 SASI_Hs01_00037678 predicted 1536
11 SASI_Hs01_00037669 predicted 837
12 SASI_Hs01_00037671 predicted 294
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053763 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080260 predicted 1133
2 SASI_Rn01_00080262 predicted 1500
3 SASI_Rn01_00080264 predicted 1254
4 SASI_Rn01_00080265 predicted 872
5 SASI_Rn01_00080266 predicted 1106
6 SASI_Rn02_00266547 predicted 1099
7 SASI_Rn02_00266548 predicted 1180
8 SASI_Rn01_00080267 predicted 1117
9 SASI_Rn01_00080268 predicted 1173
10 SASI_Rn02_00266549 predicted 1043
11 SASI_Rn01_00080259 predicted 1322
12 SASI_Rn01_00080261 predicted 240
13 SASI_Rn01_00080263 predicted 1186
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010009 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093503 predicted 1605
2 SASI_Mm02_00317614 predicted 1196
3 SASI_Mm01_00093504 predicted 987
4 SASI_Mm01_00093505 predicted 287
5 SASI_Mm01_00093506 predicted 943
6 SASI_Mm01_00093507 predicted 1562
7 SASI_Mm01_00093508 predicted 633
8 SASI_Mm01_00093509 predicted 1580
9 SASI_Mm01_00093510 predicted 1796
10 SASI_Mm01_00093511 predicted 711
11 SASI_Mm01_00093512 predicted 1181
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000785
CYP27B1 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 27, subfamily B, polypeptide 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000785.3-629s21c1
Sequence:CCGGCAACGTAGTCTGCGACCTTGTCTCGAGACAAGGTCGCAGACTACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000785.3-1078s21c1
Sequence:CCGGGAAATGTGACAGAGTTGCTATCTCGAGATAGCAACTCTGTCACATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437761    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000785.3-2080s21c1
Sequence:CCGGCTGGTTGGTCCTTCGTCTTTGCTCGAGCAAAGACGAAGGACCAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432436    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000785.3-2118s21c1
Sequence:CCGGAGGAAGGGTGAAGCCTTATTTCTCGAGAAATAAGGCTTCACCCTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000785.3-1270s21c1
Sequence:CCGGTGGTCAAGGAAGTGCTAAGACCTCGAGGTCTTAGCACTTCCTTGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000785.2-1383s1c1
Sequence:CCGGCCCATTTGCATCTCTTCCCTTCTCGAGAAGGGAAGAGATGCAAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000785.2-829s1c1
Sequence:CCGGTGGGACCAGATGTTTGCATTTCTCGAGAAATGCAAACATCTGGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000785.2-1446s1c1
Sequence:CCGGGCTTGAATTGCAAATGGCTTTCTCGAGAAAGCCATTTGCAATTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000785.2-196s1c1
Sequence:CCGGCCCAGCTTTCTGGCCGAACTTCTCGAGAAGTTCGGCCAGAAAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000785.2-1279s1c1
Sequence:CCGGCTGGTCACTCTGTGTCACTATCTCGAGATAGTGACACAGAGTGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000785
CYP27B1 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 27, subfamily B, polypeptide 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000785.3-629s21c1
Sequence:CCGGCAACGTAGTCTGCGACCTTGTCTCGAGACAAGGTCGCAGACTACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000785.3-1078s21c1
Sequence:CCGGGAAATGTGACAGAGTTGCTATCTCGAGATAGCAACTCTGTCACATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437761    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000785.3-2080s21c1
Sequence:CCGGCTGGTTGGTCCTTCGTCTTTGCTCGAGCAAAGACGAAGGACCAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432436    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000785.3-2118s21c1
Sequence:CCGGAGGAAGGGTGAAGCCTTATTTCTCGAGAAATAAGGCTTCACCCTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000785.3-1270s21c1
Sequence:CCGGTGGTCAAGGAAGTGCTAAGACCTCGAGGTCTTAGCACTTCCTTGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000785.2-1383s1c1
Sequence:CCGGCCCATTTGCATCTCTTCCCTTCTCGAGAAGGGAAGAGATGCAAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000785.2-829s1c1
Sequence:CCGGTGGGACCAGATGTTTGCATTTCTCGAGAAATGCAAACATCTGGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000785.2-1446s1c1
Sequence:CCGGGCTTGAATTGCAAATGGCTTTCTCGAGAAAGCCATTTGCAATTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000785.2-196s1c1
Sequence:CCGGCCCAGCTTTCTGGCCGAACTTCTCGAGAAGTTCGGCCAGAAAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000785.2-1279s1c1
Sequence:CCGGCTGGTCACTCTGTGTCACTATCTCGAGATAGTGACACAGAGTGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000785
CYP27B1 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 27, subfamily B, polypeptide 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000785.3-629s21c1
Sequence:CCGGCAACGTAGTCTGCGACCTTGTCTCGAGACAAGGTCGCAGACTACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000785.3-1078s21c1
Sequence:CCGGGAAATGTGACAGAGTTGCTATCTCGAGATAGCAACTCTGTCACATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437761    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000785.3-2080s21c1
Sequence:CCGGCTGGTTGGTCCTTCGTCTTTGCTCGAGCAAAGACGAAGGACCAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432436    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000785.3-2118s21c1
Sequence:CCGGAGGAAGGGTGAAGCCTTATTTCTCGAGAAATAAGGCTTCACCCTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000785.3-1270s21c1
Sequence:CCGGTGGTCAAGGAAGTGCTAAGACCTCGAGGTCTTAGCACTTCCTTGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000785.2-1383s1c1
Sequence:CCGGCCCATTTGCATCTCTTCCCTTCTCGAGAAGGGAAGAGATGCAAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000785.2-829s1c1
Sequence:CCGGTGGGACCAGATGTTTGCATTTCTCGAGAAATGCAAACATCTGGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000785.2-1446s1c1
Sequence:CCGGGCTTGAATTGCAAATGGCTTTCTCGAGAAAGCCATTTGCAATTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000785.2-196s1c1
Sequence:CCGGCCCAGCTTTCTGGCCGAACTTCTCGAGAAGTTCGGCCAGAAAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000785.2-1279s1c1
Sequence:CCGGCTGGTCACTCTGTGTCACTATCTCGAGATAGTGACACAGAGTGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010009
CYP27B1 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 27, subfamily B, polypeptide 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010009.1-1565s1c1
Sequence:CCGGAGCATCAATCTACAGTTTGTACTCGAGTACAAACTGTAGATTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010009.1-1050s1c1
Sequence:CCGGCCTGGACACTCTATGAGCTTTCTCGAGAAAGCTCATAGAGTGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010009.1-557s1c1
Sequence:CCGGCGTGACCTTGTGCGACGACTACTCGAGTAGTCGTCGCACAAGGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124839    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010009.1-1940s1c1
Sequence:CCGGGCACAAGCTAAGTGATTGCATCTCGAGATGCAATCACTTAGCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010009.1-1253s1c1
Sequence:CCGGCGTGTAGGAAACTATGTAATTCTCGAGAATTACATAGTTTCCTACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010009
CYP27B1 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 27, subfamily B, polypeptide 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010009.1-1565s1c1
Sequence:CCGGAGCATCAATCTACAGTTTGTACTCGAGTACAAACTGTAGATTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010009.1-1050s1c1
Sequence:CCGGCCTGGACACTCTATGAGCTTTCTCGAGAAAGCTCATAGAGTGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010009.1-557s1c1
Sequence:CCGGCGTGACCTTGTGCGACGACTACTCGAGTAGTCGTCGCACAAGGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124839    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010009.1-1940s1c1
Sequence:CCGGGCACAAGCTAAGTGATTGCATCTCGAGATGCAATCACTTAGCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010009.1-1253s1c1
Sequence:CCGGCGTGTAGGAAACTATGTAATTCTCGAGAATTACATAGTTTCCTACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010009
CYP27B1 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 27, subfamily B, polypeptide 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010009.1-1565s1c1
Sequence:CCGGAGCATCAATCTACAGTTTGTACTCGAGTACAAACTGTAGATTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010009.1-1050s1c1
Sequence:CCGGCCTGGACACTCTATGAGCTTTCTCGAGAAAGCTCATAGAGTGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010009.1-557s1c1
Sequence:CCGGCGTGACCTTGTGCGACGACTACTCGAGTAGTCGTCGCACAAGGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124839    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010009.1-1940s1c1
Sequence:CCGGGCACAAGCTAAGTGATTGCATCTCGAGATGCAATCACTTAGCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010009.1-1253s1c1
Sequence:CCGGCGTGTAGGAAACTATGTAATTCTCGAGAATTACATAGTTTCCTACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks