EMAIL THIS PAGE TO A FRIEND

CYP27C1

cytochrome P450, family 27, subfamily C, polypeptide 1

66 Gene Product Result for
UniProtKB ID: Q4G0S4, Q6ZNI7
Gene ID:
Human(339761) Summary: This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. [provided by RefSeq, Jul 2008]
Zebrafish(558396) cytochrome P450, family 27, subfamily C, polypeptide 1
chicken(424227) cytochrome P450, family 27, subfamily C, polypeptide 1
cow(617338) cytochrome P450, family 27, subfamily C, polypeptide 1
dog(483869) cytochrome P450, family 27, subfamily C, polypeptide 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0043 AQUA Peptide GYLIP[K] Escherichia coli O157:H7 EDL933, Pseudoalteromonas atlantica T6c, Yersinia pestis biovar Microtus str. 91001, human, mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001665 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001665 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001665 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU159591 MISSION® esiRNA esiRNA human CYP27C1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001665 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001665 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303863 predicted 1330
2 SASI_Hs01_00083900 predicted 250
3 SASI_Hs01_00083901 predicted 1018
4 SASI_Hs01_00083902 predicted 1163
5 SASI_Hs01_00083903 predicted 632
6 SASI_Hs01_00083904 predicted 1302
7 SASI_Hs01_00083905 predicted 1339
8 SASI_Hs01_00083906 predicted 952
9 SASI_Hs01_00083908 predicted 510
10 SASI_Hs01_00083909 predicted 1014
11 SASI_Hs01_00083907 predicted 402
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001665
CYP27C1 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 27, subfamily C, polypeptide 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078128    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001665.1-1761s1c1
Sequence:CCGGCCAGATTTAGATCCTGTTAAACTCGAGTTTAACAGGATCTAAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001665.1-181s1c1
Sequence:CCGGCCAAGTTATTGCTGACTTAATCTCGAGATTAAGTCAGCAATAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001665.1-1210s1c1
Sequence:CCGGGCGATTTGTTAACAGAAAGTACTCGAGTACTTTCTGTTAACAAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001665.1-733s1c1
Sequence:CCGGCCGGGAGATTGTGAAGAATTTCTCGAGAAATTCTTCACAATCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001665.1-379s1c1
Sequence:CCGGGCTCATGTTTAGCATGTTCAACTCGAGTTGAACATGCTAAACATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442262    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001665.3-1292s21c1
Sequence:CCGGCCGACACACAGTGGGTATTTGCTCGAGCAAATACCCACTGTGTGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001665
CYP27C1 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 27, subfamily C, polypeptide 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078128    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001665.1-1761s1c1
Sequence:CCGGCCAGATTTAGATCCTGTTAAACTCGAGTTTAACAGGATCTAAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001665.1-181s1c1
Sequence:CCGGCCAAGTTATTGCTGACTTAATCTCGAGATTAAGTCAGCAATAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001665.1-1210s1c1
Sequence:CCGGGCGATTTGTTAACAGAAAGTACTCGAGTACTTTCTGTTAACAAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001665.1-733s1c1
Sequence:CCGGCCGGGAGATTGTGAAGAATTTCTCGAGAAATTCTTCACAATCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001665.1-379s1c1
Sequence:CCGGGCTCATGTTTAGCATGTTCAACTCGAGTTGAACATGCTAAACATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442262    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001665.3-1292s21c1
Sequence:CCGGCCGACACACAGTGGGTATTTGCTCGAGCAAATACCCACTGTGTGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001665
CYP27C1 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 27, subfamily C, polypeptide 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078128    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001665.1-1761s1c1
Sequence:CCGGCCAGATTTAGATCCTGTTAAACTCGAGTTTAACAGGATCTAAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001665.1-181s1c1
Sequence:CCGGCCAAGTTATTGCTGACTTAATCTCGAGATTAAGTCAGCAATAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001665.1-1210s1c1
Sequence:CCGGGCGATTTGTTAACAGAAAGTACTCGAGTACTTTCTGTTAACAAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001665.1-733s1c1
Sequence:CCGGCCGGGAGATTGTGAAGAATTTCTCGAGAAATTCTTCACAATCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001665.1-379s1c1
Sequence:CCGGGCTCATGTTTAGCATGTTCAACTCGAGTTGAACATGCTAAACATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442262    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001665.3-1292s21c1
Sequence:CCGGCCGACACACAGTGGGTATTTGCTCGAGCAAATACCCACTGTGTGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks