EMAIL THIS PAGE TO A FRIEND

CYP2A13

cytochrome P450, family 2, subfamily A, polypeptide 13

21 Gene Product Result for
Synonyms: CPAD CYP2A CYPIIA13
UniProtKB ID: Q16696, Q53YR8, Q6R569, Q6R570, Q9H2X2
Gene ID:
Human(1553) Summary: This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum. Although its endogenous substrate has not been determined, it is known to metabolize 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone, a major nitrosamine specific to tobacco. This gene is part of a large cluster of cytochrome P450 genes from the CYP2A, CYP2B and CYP2F subfamilies on chromosome 19q. [provided by RefSeq, Jul 2008]
chicken(427657) cytochrome P450, family 2, subfamily A, polypeptide 13
dog(484494) cytochrome P450 family 2 subfamily A polypeptide 13
Horse(100064882) cytochrome P450, family 2, subfamily A, polypeptide 13
cow(540707) cytochrome P450, family 2, subfamily A, polypeptide 13-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0032 AQUA Peptide VHEEID[R] African clawed frog, cow, dog, human, mouse, pig, rat pricing
AQ0102 AQUA Peptide DFIDSFLI[R] cow, dog, human, mouse, pig, rat pricing
AQ0033 AQUA Peptide HVGFATIP[R] dog, human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000766 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000766 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000766 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU152841 MISSION® esiRNA esiRNA human CYP2A13 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000766 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000766 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057296 predicted 870
2 SASI_Hs01_00057297 predicted 1703
3 SASI_Hs01_00057298 predicted 1636
4 SASI_Hs01_00057300 predicted 1638
5 SASI_Hs01_00057301 predicted 1702
6 SASI_Hs01_00057299 predicted 1692
7 SASI_Hs01_00057302 predicted 1688
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000766
CYP2A13 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 2, subfamily A, polypeptide 13
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000766.3-1374s1c1
Sequence:CCGGCATCATGCAGAACTTTCGCTTCTCGAGAAGCGAAAGTTCTGCATGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000766.3-802s1c1
Sequence:CCGGCGGGACTTCATCGACTCCTTTCTCGAGAAAGGAGTCGATGAAGTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000766.3-1248s1c1
Sequence:CCGGCCAGCACTTCCTGGATAAGAACTCGAGTTCTTATCCAGGAAGTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000766.3-51s1c1
Sequence:CCGGCCTGACTGTGATGGTCTTGATCTCGAGATCAAGACCATCACAGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000766.3-207s1c1
Sequence:CCGGCCCTGTGTTCACCATTCACTTCTCGAGAAGTGAATGGTGAACACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000766
CYP2A13 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 2, subfamily A, polypeptide 13
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000766.3-1374s1c1
Sequence:CCGGCATCATGCAGAACTTTCGCTTCTCGAGAAGCGAAAGTTCTGCATGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000766.3-802s1c1
Sequence:CCGGCGGGACTTCATCGACTCCTTTCTCGAGAAAGGAGTCGATGAAGTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000766.3-1248s1c1
Sequence:CCGGCCAGCACTTCCTGGATAAGAACTCGAGTTCTTATCCAGGAAGTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000766.3-51s1c1
Sequence:CCGGCCTGACTGTGATGGTCTTGATCTCGAGATCAAGACCATCACAGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000766.3-207s1c1
Sequence:CCGGCCCTGTGTTCACCATTCACTTCTCGAGAAGTGAATGGTGAACACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000766
CYP2A13 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 2, subfamily A, polypeptide 13
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000766.3-1374s1c1
Sequence:CCGGCATCATGCAGAACTTTCGCTTCTCGAGAAGCGAAAGTTCTGCATGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000766.3-802s1c1
Sequence:CCGGCGGGACTTCATCGACTCCTTTCTCGAGAAAGGAGTCGATGAAGTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000766.3-1248s1c1
Sequence:CCGGCCAGCACTTCCTGGATAAGAACTCGAGTTCTTATCCAGGAAGTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000766.3-51s1c1
Sequence:CCGGCCTGACTGTGATGGTCTTGATCTCGAGATCAAGACCATCACAGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000766.3-207s1c1
Sequence:CCGGCCCTGTGTTCACCATTCACTTCTCGAGAAGTGAATGGTGAACACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)