EMAIL THIS PAGE TO A FRIEND

CYP2A6

cytochrome P450, family 2, subfamily A, polypeptide 6

43 Gene Product Result for
Synonyms: CPA6 CYP2A CYP2A3 CYPIIA6 P450C2A P450PB
Gene ID:
Human(1548) Summary: This gene, CYP2A6, encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and its expression is induced by phenobarbital. The enzyme is known to hydroxylate coumarin, and also metabolizes nicotine, aflatoxin B1, nitrosamines, and some pharmaceuticals. Individuals with certain allelic variants are said to have a poor metabolizer phenotype, meaning they do not efficiently metabolize coumarin or nicotine. This gene is part of a large cluster of cytochrome P450 genes from the CYP2A, CYP2B and CYP2F subfamilies on chromosome 19q. The gene was formerly referred to as CYP2A3; however, it has been renamed CYP2A6. [provided by RefSeq, Jul 2008]
sheep(100568289) cytochrome P450 2A6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
588490 Poly(2,5 pyridine) human pricing
C5923 (−)-Cotinine ≥98% human, mouse pricing
C0430 (−)-Cotinine solution drug standard, 1.0 mg/mL in methanol human, mouse pricing
33990 1,4-Dibromobenzene purum, ≥97.0% (GC) human, mouse pricing
D39029 1,4-Dibromobenzene 98% human, mouse pricing
35775 1,4-Dichlorobenzene PESTANAL®, analytical standard human, mouse pricing
D56829 1,4-Dichlorobenzene ≥99% human, mouse pricing
304654 1,4-Dichlorobenzene-UL-14C neat human, mouse pricing
251321 1,5-Dimethylnaphthalene 98% human, mouse pricing
409901 1,7-Dimethylnaphthalene 99% human, mouse pricing
264938 1-Methylisoquinoline 97% human, mouse pricing
183644 2-Bromonaphthalene 97% human, mouse pricing
M57006 2-Methylnaphthalene (β) 97% human, mouse pricing
87661 α-Tetralone purum, ≥96.0% (GC) human, mouse pricing
T19003 α-Tetralone 97% human, mouse pricing
T19208 β-Tetralone 98% human, mouse pricing
112410 Dimethylnaphthalene, mixture of isomers human, mouse pricing
40053 Naphthalene solution certified reference material, 5000 μg/mL in methanol human, mouse pricing
48661 Phenanthrene solution certified reference material, 200 μg/mL in dichloromethane human, mouse pricing
40079 Phenanthrene solution certified reference material, 5000 μg/mL in methanol human, mouse pricing
N3876 (−)-Nicotine ≥99% (GC), liquid human, mouse, rat pricing
36733 (−)-Nicotine PESTANAL®, analytical standard human, mouse, rat pricing
46343 (−)-Nicotine solution 100 μg/mL in acetonitrile, PESTANAL®, analytical standard human, mouse, rat pricing
N5511 (−)-Nicotine solution 1.0 mg/mL, analytical standard, for drug analysis human, mouse, rat pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0032 AQUA Peptide VHEEID[R] African clawed frog, cow, dog, human, mouse, pig, rat pricing
AQ0102 AQUA Peptide DFIDSFLI[R] cow, dog, human, mouse, pig, rat pricing
AQ0033 AQUA Peptide HVGFATIP[R] dog, human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000762 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000762 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000762 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000762 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000762 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080114 predicted 1108
2 SASI_Hs01_00080115 predicted 876
3 SASI_Hs01_00080116 predicted 1245
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000762
CYP2A6 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 2, subfamily A, polypeptide 6
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000762.4-802s1c1
Sequence:CCGGCGGGACTTCATTGACTCCTTTCTCGAGAAAGGAGTCAATGAAGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000762.4-51s1c1
Sequence:CCGGCCTGACTGTAATGGTCTTGATCTCGAGATCAAGACCATTACAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000762.4-1086s1c1
Sequence:CCGGCCAAAGATTTGGAGACGTGATCTCGAGATCACGTCTCCAAATCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000762.4-342s1c1
Sequence:CCGGCAAAGGCTATGGCGTGGTATTCTCGAGAATACCACGCCATAGCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000762.4-577s1c1
Sequence:CCGGCGCTTTGACTATAAGGACAAACTCGAGTTTGTCCTTATAGTCAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000762.5-1321s21c1
Sequence:CCGGATCGGAAAGCGGAACTGTTTCCTCGAGGAAACAGTTCCGCTTTCCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000762.5-686s21c1
Sequence:CCGCTGTTCTCTTCGGTGATGAAACCTCGAGGTTTCATCACCGAAGAGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000762
CYP2A6 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 2, subfamily A, polypeptide 6
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000762.4-802s1c1
Sequence:CCGGCGGGACTTCATTGACTCCTTTCTCGAGAAAGGAGTCAATGAAGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000762.4-51s1c1
Sequence:CCGGCCTGACTGTAATGGTCTTGATCTCGAGATCAAGACCATTACAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000762.4-1086s1c1
Sequence:CCGGCCAAAGATTTGGAGACGTGATCTCGAGATCACGTCTCCAAATCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000762.4-342s1c1
Sequence:CCGGCAAAGGCTATGGCGTGGTATTCTCGAGAATACCACGCCATAGCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000762.4-577s1c1
Sequence:CCGGCGCTTTGACTATAAGGACAAACTCGAGTTTGTCCTTATAGTCAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000762.5-1321s21c1
Sequence:CCGGATCGGAAAGCGGAACTGTTTCCTCGAGGAAACAGTTCCGCTTTCCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000762.5-686s21c1
Sequence:CCGCTGTTCTCTTCGGTGATGAAACCTCGAGGTTTCATCACCGAAGAGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000762
CYP2A6 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 2, subfamily A, polypeptide 6
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000762.4-802s1c1
Sequence:CCGGCGGGACTTCATTGACTCCTTTCTCGAGAAAGGAGTCAATGAAGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000762.4-51s1c1
Sequence:CCGGCCTGACTGTAATGGTCTTGATCTCGAGATCAAGACCATTACAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000762.4-1086s1c1
Sequence:CCGGCCAAAGATTTGGAGACGTGATCTCGAGATCACGTCTCCAAATCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000762.4-342s1c1
Sequence:CCGGCAAAGGCTATGGCGTGGTATTCTCGAGAATACCACGCCATAGCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000762.4-577s1c1
Sequence:CCGGCGCTTTGACTATAAGGACAAACTCGAGTTTGTCCTTATAGTCAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000762.5-1321s21c1
Sequence:CCGGATCGGAAAGCGGAACTGTTTCCTCGAGGAAACAGTTCCGCTTTCCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000762.5-686s21c1
Sequence:CCGCTGTTCTCTTCGGTGATGAAACCTCGAGGTTTCATCACCGAAGAGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks