EMAIL THIS PAGE TO A FRIEND

CYP2A7

cytochrome P450, family 2, subfamily A, polypeptide 7

25 Gene Product Result for
Synonyms: CPA7 CPAD CYP2A CYPIIA7 P450-IIA4
UniProtKB ID: P20853, Q13121
Gene ID:
Human(1549) Summary: This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum; its substrate has not yet been determined. This gene, which produces two transcript variants, is part of a large cluster of cytochrome P450 genes from the CYP2A, CYP2B and CYP2F subfamilies on chromosome 19q. [provided by RefSeq, Jul 2008]
dog(484493) cytochrome P450, family 2, subfamily A, polypeptide 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0032 AQUA Peptide VHEEID[R] African clawed frog, cow, dog, human, mouse, pig, rat pricing
AQ0102 AQUA Peptide DFIDSFLI[R] cow, dog, human, mouse, pig, rat pricing
AQ0033 AQUA Peptide HVGFATIP[R] dog, human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000764 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000764 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000764 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU112801 MISSION® esiRNA esiRNA human CYP2A7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000764 Rosetta Predictions human pricing
NM_030589 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000764 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123823 predicted 1640
2 SASI_Hs01_00123824 predicted 1134
3 SASI_Hs01_00123825 predicted 1411
4 SASI_Hs01_00123826 predicted 708
5 SASI_Hs01_00123827 predicted 698
6 SASI_Hs01_00123828 predicted 710
7 SASI_Hs01_00123829 predicted 685
8 SASI_Hs01_00123822 predicted 1641
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030589 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161466 predicted 1488
2 SASI_Hs01_00161467 predicted 980
3 SASI_Hs01_00161468 predicted 1253
4 SASI_Hs01_00161469 predicted 691
5 SASI_Hs01_00161470 predicted 678
6 SASI_Hs01_00161465 predicted 1495
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000764
CYP2A7 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 2, subfamily A, polypeptide 7
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000764.2-1578s21c1
Sequence:CCGGCGGACCAAGATGCCCTACATGCTCGAGCATGTAGGGCATCTTGGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000764.2-1409s1c1
Sequence:CCGGGAACCTGATGATGAGCACGTTCTCGAGAACGTGCTCATCATCAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000764.2-698s1c1
Sequence:CCGGGCACATATGTGACTCCATCATCTCGAGATGATGGAGTCACATATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000764.2-1758s1c1
Sequence:CCGGTCCAACCCTCAGGACTTCAATCTCGAGATTGAAGTCCTGAGGGTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000764.2-685s1c1
Sequence:CCGGAGCTGAACACAGAGCACATATCTCGAGATATGTGCTCTGTGTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000764.2-1110s1c1
Sequence:CCGGCGCTTTGACTATGAGGACAAACTCGAGTTTGTCCTCATAGTCAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000764
CYP2A7 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 2, subfamily A, polypeptide 7
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000764.2-1578s21c1
Sequence:CCGGCGGACCAAGATGCCCTACATGCTCGAGCATGTAGGGCATCTTGGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000764.2-1409s1c1
Sequence:CCGGGAACCTGATGATGAGCACGTTCTCGAGAACGTGCTCATCATCAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000764.2-698s1c1
Sequence:CCGGGCACATATGTGACTCCATCATCTCGAGATGATGGAGTCACATATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000764.2-1758s1c1
Sequence:CCGGTCCAACCCTCAGGACTTCAATCTCGAGATTGAAGTCCTGAGGGTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000764.2-685s1c1
Sequence:CCGGAGCTGAACACAGAGCACATATCTCGAGATATGTGCTCTGTGTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000764.2-1110s1c1
Sequence:CCGGCGCTTTGACTATGAGGACAAACTCGAGTTTGTCCTCATAGTCAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000764
CYP2A7 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 2, subfamily A, polypeptide 7
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000764.2-1578s21c1
Sequence:CCGGCGGACCAAGATGCCCTACATGCTCGAGCATGTAGGGCATCTTGGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000764.2-1409s1c1
Sequence:CCGGGAACCTGATGATGAGCACGTTCTCGAGAACGTGCTCATCATCAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000764.2-698s1c1
Sequence:CCGGGCACATATGTGACTCCATCATCTCGAGATGATGGAGTCACATATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000764.2-1758s1c1
Sequence:CCGGTCCAACCCTCAGGACTTCAATCTCGAGATTGAAGTCCTGAGGGTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000764.2-685s1c1
Sequence:CCGGAGCTGAACACAGAGCACATATCTCGAGATATGTGCTCTGTGTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000764.2-1110s1c1
Sequence:CCGGCGCTTTGACTATGAGGACAAACTCGAGTTTGTCCTCATAGTCAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks