EMAIL THIS PAGE TO A FRIEND

CYP2C18

cytochrome P450, family 2, subfamily C, polypeptide 18

21 Gene Product Result for
Synonyms: CPCI CYP2C CYP2C17 P450-6B/29C P450IIC17
UniProtKB ID: P33260, B2R8K2, Q16703, Q16751, Q4VAT5, Q6GRG1
Gene ID:
Human(1562) Summary: This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum but its specific substrate has not yet been determined. The gene is located within a cluster of cytochrome P450 genes on chromosome 10q24. An additional gene, CYP2C17, was once thought to exist; however, CYP2C17 is now considered an artefact based on a chimera of CYP2C18 and CYP2C19. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
sheep(100568290) cytochrome P450 2C18
chicken(414841) cytochrome P450, family 2, subfamily C, polypeptide 18
cow(535243) cytochrome P450, family 2, subfamily C, polypeptide 18
dog(415122) cytochrome P450 2C21
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
S0758 Sulfaphenazole ≥98% human pricing
UC166 Sulfaphenazole ≥98% (HPLC) human pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0038 AQUA Peptide VQEEA[R] Drosophila melanogaster, cow, human, mouse, pig, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000772 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000772 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000772 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU066221 MISSION® esiRNA esiRNA human CYP2C18 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000772 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000772 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063403 predicted 1371
2 SASI_Hs01_00063404 predicted 841
3 SASI_Hs01_00063405 predicted 1731
4 SASI_Hs01_00063406 predicted 744
5 SASI_Hs01_00063407 predicted 1024
6 SASI_Hs01_00063408 predicted 743
7 SASI_Hs01_00063409 predicted 1024
8 SASI_Hs01_00063410 predicted 1204
9 SASI_Hs01_00063411 predicted 1363
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000772
CYP2C18 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 2, subfamily C, polypeptide 18
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000772.2-853s21c1
Sequence:CCGGATGTGATCTGCTCTGTTATTTCTCGAGAAATAACAGAGCAGATCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419868    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000772.2-1941s21c1
Sequence:CCGGGAACATCCAACCTCCATTAAACTCGAGTTTAATGGAGGTTGGATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000772.1-1064s1c1
Sequence:CCGGGCCACTGTAACTGATATGTTTCTCGAGAAACATATCAGTTACAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000772.1-307s1c1
Sequence:CCGGCCCGATTATTGGAAATATCCTCTCGAGAGGATATTTCCAATAATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000772.1-874s1c1
Sequence:CCGGTCTCCCAGGAAGTCATAATAACTCGAGTTATTATGACTTCCTGGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000772.1-1379s1c1
Sequence:CCGGGTGCTGCACAATGACAAAGAACTCGAGTTCTTTGTCATTGTGCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000772.1-1353s1c1
Sequence:CCGGCGACCATAATAACATCCCTGACTCGAGTCAGGGATGTTATTATGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000772
CYP2C18 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 2, subfamily C, polypeptide 18
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000772.2-853s21c1
Sequence:CCGGATGTGATCTGCTCTGTTATTTCTCGAGAAATAACAGAGCAGATCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419868    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000772.2-1941s21c1
Sequence:CCGGGAACATCCAACCTCCATTAAACTCGAGTTTAATGGAGGTTGGATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000772.1-1064s1c1
Sequence:CCGGGCCACTGTAACTGATATGTTTCTCGAGAAACATATCAGTTACAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000772.1-307s1c1
Sequence:CCGGCCCGATTATTGGAAATATCCTCTCGAGAGGATATTTCCAATAATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000772.1-874s1c1
Sequence:CCGGTCTCCCAGGAAGTCATAATAACTCGAGTTATTATGACTTCCTGGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000772.1-1379s1c1
Sequence:CCGGGTGCTGCACAATGACAAAGAACTCGAGTTCTTTGTCATTGTGCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000772.1-1353s1c1
Sequence:CCGGCGACCATAATAACATCCCTGACTCGAGTCAGGGATGTTATTATGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000772
CYP2C18 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 2, subfamily C, polypeptide 18
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000772.2-853s21c1
Sequence:CCGGATGTGATCTGCTCTGTTATTTCTCGAGAAATAACAGAGCAGATCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419868    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000772.2-1941s21c1
Sequence:CCGGGAACATCCAACCTCCATTAAACTCGAGTTTAATGGAGGTTGGATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000772.1-1064s1c1
Sequence:CCGGGCCACTGTAACTGATATGTTTCTCGAGAAACATATCAGTTACAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000772.1-307s1c1
Sequence:CCGGCCCGATTATTGGAAATATCCTCTCGAGAGGATATTTCCAATAATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000772.1-874s1c1
Sequence:CCGGTCTCCCAGGAAGTCATAATAACTCGAGTTATTATGACTTCCTGGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000772.1-1379s1c1
Sequence:CCGGGTGCTGCACAATGACAAAGAACTCGAGTTCTTTGTCATTGTGCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000772.1-1353s1c1
Sequence:CCGGCGACCATAATAACATCCCTGACTCGAGTCAGGGATGTTATTATGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks