EMAIL THIS PAGE TO A FRIEND

CYP2C19

cytochrome P450, family 2, subfamily C, polypeptide 19

27 Gene Product Result for
Synonyms: CPCJ CYP2C P450C2C P450IIC19
UniProtKB ID: P33261, P33259, Q8WZB1, Q8WZB2, Q9UCD4
Gene ID:
Human(1557) Summary: This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and is known to metabolize many xenobiotics, including the anticonvulsive drug mephenytoin, omeprazole, diazepam and some barbiturates. Polymorphism within this gene is associated with variable ability to metabolize mephenytoin, known as the poor metabolizer and extensive metabolizer phenotypes. The gene is located within a cluster of cytochrome P450 genes on chromosome 10q24. [provided by RefSeq, Jul 2008]
cow(510380) cytochrome P450, family 2, subfamily C, polypeptide 19
sheep(100534653) cytochrome P450 2C19
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2100520 Anti-CYP2C19 antibody produced in rabbit affinity isolated antibody pig, rat, horse, goat, sheep, mouse, rabbit, guinea pig, rabbit, bovine, canine, human
western blot pricing
SAB4500590 Anti-Cytochrome P450 2C19 antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing

Proteins

Product # Description Species Add to Cart
 
MTOXCE2C19 CypExpress 2C19 Cytochrome P450 human human pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0038 AQUA Peptide VQEEA[R] Drosophila melanogaster, cow, human, mouse, pig, rat pricing
AQ0039 AQUA Peptide HPEVTA[K] cow, human pricing
AQ0036 AQUA Peptide SLTNLS[K] cow, human pricing
AQ0037 AQUA Peptide GHFPLAE[R] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000769 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000769 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000769 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU127101 MISSION® esiRNA esiRNA human CYP2C19 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000769 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000769 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239932 predicted 288
2 SASI_Hs01_00239933 predicted 543
3 SASI_Hs01_00239934 predicted 288
4 SASI_Hs01_00239936 predicted 859
5 SASI_Hs01_00239937 predicted 651
6 SASI_Hs01_00239938 predicted 828
7 SASI_Hs01_00239935 predicted 684
8 SASI_Hs01_00239939 predicted 1394
9 SASI_Hs01_00239940 predicted 144
10 SASI_Hs01_00239941 predicted 1394
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000769
CYP2C19 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 2, subfamily C, polypeptide 19
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000769.1-186s1c1
Sequence:CCGGCCCTGTGTTCACTCTGTATTTCTCGAGAAATACAGAGTGAACACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000769.1-103s1c1
Sequence:CCGGCCTCTCCCAGTGATTGGAAATCTCGAGATTTCCAATCACTGGGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000769.1-1157s1c1
Sequence:CCGGCCATATTAACTTCCCTCACTTCTCGAGAAGTGAGGGAAGTTAATATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000769.1-1225s1c1
Sequence:CCGGCCTCGTCACTTTCTGGATGAACTCGAGTTCATCCAGAAAGTGACGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000769.1-1065s1c1
Sequence:CCGGCCAGAGATACATCGACCTCATCTCGAGATGAGGTCGATGTATCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000769.1-1446s21c1
Sequence:CCGGCTATCAGCTGTGCTTCATTCCCTCGAGGGAATGAAGCACAGCTGATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000769.1-656s21c1
Sequence:CCGGTTCCCACTATCATTGATTATTCTCGAGAATAATCAATGATAGTGGGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000769.1-136s21c1
Sequence:CCGGGATATTAAGGATGTCAGCAAACTCGAGTTTGCTGACATCCTTAATATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000769
CYP2C19 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 2, subfamily C, polypeptide 19
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000769.1-186s1c1
Sequence:CCGGCCCTGTGTTCACTCTGTATTTCTCGAGAAATACAGAGTGAACACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000769.1-103s1c1
Sequence:CCGGCCTCTCCCAGTGATTGGAAATCTCGAGATTTCCAATCACTGGGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000769.1-1157s1c1
Sequence:CCGGCCATATTAACTTCCCTCACTTCTCGAGAAGTGAGGGAAGTTAATATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000769.1-1225s1c1
Sequence:CCGGCCTCGTCACTTTCTGGATGAACTCGAGTTCATCCAGAAAGTGACGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000769.1-1065s1c1
Sequence:CCGGCCAGAGATACATCGACCTCATCTCGAGATGAGGTCGATGTATCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000769.1-1446s21c1
Sequence:CCGGCTATCAGCTGTGCTTCATTCCCTCGAGGGAATGAAGCACAGCTGATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000769.1-656s21c1
Sequence:CCGGTTCCCACTATCATTGATTATTCTCGAGAATAATCAATGATAGTGGGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000769.1-136s21c1
Sequence:CCGGGATATTAAGGATGTCAGCAAACTCGAGTTTGCTGACATCCTTAATATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000769
CYP2C19 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 2, subfamily C, polypeptide 19
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000769.1-186s1c1
Sequence:CCGGCCCTGTGTTCACTCTGTATTTCTCGAGAAATACAGAGTGAACACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000769.1-103s1c1
Sequence:CCGGCCTCTCCCAGTGATTGGAAATCTCGAGATTTCCAATCACTGGGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000769.1-1157s1c1
Sequence:CCGGCCATATTAACTTCCCTCACTTCTCGAGAAGTGAGGGAAGTTAATATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000769.1-1225s1c1
Sequence:CCGGCCTCGTCACTTTCTGGATGAACTCGAGTTCATCCAGAAAGTGACGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000769.1-1065s1c1
Sequence:CCGGCCAGAGATACATCGACCTCATCTCGAGATGAGGTCGATGTATCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000769.1-1446s21c1
Sequence:CCGGCTATCAGCTGTGCTTCATTCCCTCGAGGGAATGAAGCACAGCTGATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000769.1-656s21c1
Sequence:CCGGTTCCCACTATCATTGATTATTCTCGAGAATAATCAATGATAGTGGGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000769.1-136s21c1
Sequence:CCGGGATATTAAGGATGTCAGCAAACTCGAGTTTGCTGACATCCTTAATATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)