EMAIL THIS PAGE TO A FRIEND

CYP2C8

cytochrome P450, family 2, subfamily C, polypeptide 8

Synonyms: CPC8 CYPIIC8 MP-12/MP-20
Species: Human CYP2C8(1558)
Gene ID:
Human(1558) Summary: This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and its expression is induced by phenobarbital. The enzyme is known to metabolize many xenobiotics, including the anticonvulsive drug mephenytoin, benzo(a)pyrene, 7-ethyoxycoumarin, and the anti-cancer drug taxol. This gene is located within a cluster of cytochrome P450 genes on chromosome 10q24. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
27 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
T9652 Terfenadine human, mouse, rat pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0039 AQUA Peptide HPEVTA[K] cow, human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000770 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000770 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000770 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU068961 MISSION® esiRNA esiRNA human CYP2C8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000770 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000770 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011798 predicted 1589
2 SASI_Hs01_00011799 predicted 303
3 SASI_Hs01_00011800 predicted 623
4 SASI_Hs01_00011801 predicted 1508
5 SASI_Hs01_00011802 predicted 522
6 SASI_Hs02_00303196 predicted 240
7 SASI_Hs01_00011803 predicted 848
8 SASI_Hs01_00011805 predicted 1621
9 SASI_Hs01_00011807 predicted 308
10 SASI_Hs02_00303197 predicted 1484
11 SASI_Hs01_00011804 predicted 642
12 SASI_Hs01_00011806 predicted 418
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000770
VALIDATED
CYP2C8 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 2, subfamily C, polypeptide 8
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_000770.2-404s1c1
Sequence:CCGGCCTCACAAACTTGCGGAATTTCTCGAGAAATTCCGCAAGTTTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000770.2-1135s1c1
Sequence:CCGGCCACTGATACTAAGTTCAGAACTCGAGTTCTGAACTTAGTATCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000770.2-744s1c1
Sequence:CCGGCGAAGTTACATTAGGGAGAAACTCGAGTTTCTCCCTAATGTAACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000770.2-1434s1c1
Sequence:CCGGGCAGTTACCAAAGGGATTGTTCTCGAGAACAATCCCTTTGGTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000770.2-126s1c1
Sequence:CCGGCCTCTTCCTATTATTGGAAATCTCGAGATTTCCAATAATAGGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000770.3-848s21c1
Sequence:CCGGCCAAGCATCACTGGATGTTAACTCGAGTTAACATCCAGTGATGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235065    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000770.3-1624s21c1
Sequence:CCGGCAAGGACATTCCCACTATTATCTCGAGATAATAGTGGGAATGTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000770.3-804s21c1
Sequence:CCGGGTTGCTCTTACACGAAGTTACCTCGAGGTAACTTCGTGTAAGAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000770.3-476s21c1
Sequence:CCGGCCTCACAACCTTGCGGAATTTCTCGAGAAATTCCGCAAGGTTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000770.3-959s21c1
Sequence:CCGGTGGCACTGTAGCTGATCTATTCTCGAGAATAGATCAGCTACAGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000770
VALIDATED
CYP2C8 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 2, subfamily C, polypeptide 8
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_000770.2-404s1c1
Sequence:CCGGCCTCACAAACTTGCGGAATTTCTCGAGAAATTCCGCAAGTTTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000770.2-1135s1c1
Sequence:CCGGCCACTGATACTAAGTTCAGAACTCGAGTTCTGAACTTAGTATCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000770.2-744s1c1
Sequence:CCGGCGAAGTTACATTAGGGAGAAACTCGAGTTTCTCCCTAATGTAACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000770.2-1434s1c1
Sequence:CCGGGCAGTTACCAAAGGGATTGTTCTCGAGAACAATCCCTTTGGTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000770.2-126s1c1
Sequence:CCGGCCTCTTCCTATTATTGGAAATCTCGAGATTTCCAATAATAGGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000770.3-848s21c1
Sequence:CCGGCCAAGCATCACTGGATGTTAACTCGAGTTAACATCCAGTGATGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235065    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000770.3-1624s21c1
Sequence:CCGGCAAGGACATTCCCACTATTATCTCGAGATAATAGTGGGAATGTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000770.3-804s21c1
Sequence:CCGGGTTGCTCTTACACGAAGTTACCTCGAGGTAACTTCGTGTAAGAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000770.3-476s21c1
Sequence:CCGGCCTCACAACCTTGCGGAATTTCTCGAGAAATTCCGCAAGGTTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000770.3-959s21c1
Sequence:CCGGTGGCACTGTAGCTGATCTATTCTCGAGAATAGATCAGCTACAGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000770
VALIDATED
CYP2C8 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 2, subfamily C, polypeptide 8
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_000770.2-404s1c1
Sequence:CCGGCCTCACAAACTTGCGGAATTTCTCGAGAAATTCCGCAAGTTTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000770.2-1135s1c1
Sequence:CCGGCCACTGATACTAAGTTCAGAACTCGAGTTCTGAACTTAGTATCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000770.2-744s1c1
Sequence:CCGGCGAAGTTACATTAGGGAGAAACTCGAGTTTCTCCCTAATGTAACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000770.2-1434s1c1
Sequence:CCGGGCAGTTACCAAAGGGATTGTTCTCGAGAACAATCCCTTTGGTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000770.2-126s1c1
Sequence:CCGGCCTCTTCCTATTATTGGAAATCTCGAGATTTCCAATAATAGGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000770.3-848s21c1
Sequence:CCGGCCAAGCATCACTGGATGTTAACTCGAGTTAACATCCAGTGATGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235065    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000770.3-1624s21c1
Sequence:CCGGCAAGGACATTCCCACTATTATCTCGAGATAATAGTGGGAATGTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000770.3-804s21c1
Sequence:CCGGGTTGCTCTTACACGAAGTTACCTCGAGGTAACTTCGTGTAAGAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000770.3-476s21c1
Sequence:CCGGCCTCACAACCTTGCGGAATTTCTCGAGAAATTCCGCAAGGTTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000770.3-959s21c1
Sequence:CCGGTGGCACTGTAGCTGATCTATTCTCGAGAATAGATCAGCTACAGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks