EMAIL THIS PAGE TO A FRIEND

CYP2C9

cytochrome P450, family 2, subfamily C, polypeptide 9

59 Gene Product Result for
Synonyms: CPC9 CYP2C CYP2C10 CYPIIC9 P450IIC9
Species: Human CYP2C9(1559)
UniProtKB ID: P11712, P11713, Q16756, Q16872, Q5VX92
Gene ID:
Human(1559) Summary: This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and its expression is induced by rifampin. The enzyme is known to metabolize many xenobiotics, including phenytoin, tolbutamide, ibuprofen and S-warfarin. Studies identifying individuals who are poor metabolizers of phenytoin and tolbutamide suggest that this gene is polymorphic. The gene is located within a cluster of cytochrome P450 genes on chromosome 10q24. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
UC213 (R)-(+)-Warfarin ≥97% (HPLC) human pricing
UC214 (S)-(−)-Warfarin ≥97% (HPLC) human pricing
M1390 3,3′-Methylene-bis(4-hydroxycoumarin) human pricing
B5774 Benzbromarone analytical standard human pricing
P8386 Phenylbutazone human pricing
S8307 SB 203580 solid, ≥98% (HPLC) human pricing
S0758 Sulfaphenazole ≥98% human pricing
UC166 Sulfaphenazole ≥98% (HPLC) human pricing
T8904 Thiabendazole ≥99%, powder human pricing
T5535 Thiabendazole BioReagent, plant cell culture tested, powder human pricing
45684 Thiabendazole PESTANAL®, analytical standard human pricing
60010 Kaempferol ≥97.0% (HPLC) human, mouse pricing
K0133 Kaempferol ≥90% (HPLC), powder human, mouse pricing
46968 Tolbutamide VETRANAL, analytical standard human, mouse pricing
I4883 Ibuprofen ≥98% (GC) human, mouse, rat pricing
I7905 Ibuprofen meets USP testing specifications human, mouse, rat pricing
P0130 Progesterone ≥99% human, mouse, rat pricing
P6149 Progesterone γ-irradiated, BioXtra, suitable for cell culture human, mouse, rat pricing
P8783 Progesterone powder, BioReagent, suitable for cell culture human, mouse, rat pricing
P3972 Progesterone meets USP testing specifications human, mouse, rat pricing
46665 Progesterone VETRANAL, analytical standard human, mouse, rat pricing
P7556 Progesterone-Water Soluble powder, BioReagent, suitable for cell culture human, mouse, rat pricing
D4007 5,5-Diphenylhydantoin ≥99% human, rat pricing
D4505 5,5-Diphenylhydantoin sodium salt ≥99% human, rat pricing
F8514 Flurbiprofen cyclooxygenase inhibitor human, rat pricing
46706 Pyrimethamine VETRANAL, analytical standard human, rat pricing
22620 Quinine suitable for fluorescence, anhydrous, ≥98.0% (dried material, NT) human, rat pricing
145904 Quinine 90% human, rat pricing

Small Molecule - Substrate

Product # Description Species Add to Cart
 
T0891 Tolbutamide analytical standard human, mouse pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0038 AQUA Peptide VQEEA[R] Drosophila melanogaster, cow, human, mouse, pig, rat pricing
AQ0039 AQUA Peptide HPEVTA[K] cow, human pricing
AQ0036 AQUA Peptide SLTNLS[K] cow, human pricing
AQ0035 AQUA Peptide GIFPLAE[R] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000771 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000771 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000771 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU111841 MISSION® esiRNA esiRNA human CYP2C9 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000771 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000771 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184196 predicted 1523
2 SASI_Hs01_00184197 predicted 827
3 SASI_Hs01_00184198 predicted 1541
4 SASI_Hs01_00184199 predicted 752
5 SASI_Hs02_00303198 predicted 1110
6 SASI_Hs01_00184200 predicted 673
7 SASI_Hs02_00303199 predicted 1557
8 SASI_Hs02_00303200 predicted 1552
9 SASI_Hs02_00303201 predicted 1558
10 SASI_Hs01_00184201 predicted 151
11 SASI_Hs01_00184202 predicted 134
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000771
CYP2C9 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 2, subfamily C, polypeptide 9
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434620    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000771.3-1558s21c1
Sequence:CCGGCATTATCCATCTTTCACTATCCTCGAGGATAGTGAAAGATGGATAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418357    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000771.3-1652s21c1
Sequence:CCCGACGGAGAGTTTCCTATGTTTCCTCGAGGAAACATAGGAAACTCTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000771.2-825s1c1
Sequence:CCGGGCACAACCAACCATCTGAATTCTCGAGAATTCAGATGGTTGGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000771.2-186s1c1
Sequence:CCGGCCCGGTGTTCACTCTGTATTTCTCGAGAAATACAGAGTGAACACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000771.2-1112s1c1
Sequence:CCGGCCTGTGACATTAAATTCAGAACTCGAGTTCTGAATTTAATGTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000771.2-679s1c1
Sequence:CCGGCCGGGAACTCACAACAAATTACTCGAGTAATTTGTTGTGAGTTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000771.2-1210s1c1
Sequence:CCGGCCAGAGATGTTTGACCCTCATCTCGAGATGAGGGTCAAACATCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000771
CYP2C9 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 2, subfamily C, polypeptide 9
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434620    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000771.3-1558s21c1
Sequence:CCGGCATTATCCATCTTTCACTATCCTCGAGGATAGTGAAAGATGGATAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418357    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000771.3-1652s21c1
Sequence:CCCGACGGAGAGTTTCCTATGTTTCCTCGAGGAAACATAGGAAACTCTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000771.2-825s1c1
Sequence:CCGGGCACAACCAACCATCTGAATTCTCGAGAATTCAGATGGTTGGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000771.2-186s1c1
Sequence:CCGGCCCGGTGTTCACTCTGTATTTCTCGAGAAATACAGAGTGAACACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000771.2-1112s1c1
Sequence:CCGGCCTGTGACATTAAATTCAGAACTCGAGTTCTGAATTTAATGTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000771.2-679s1c1
Sequence:CCGGCCGGGAACTCACAACAAATTACTCGAGTAATTTGTTGTGAGTTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000771.2-1210s1c1
Sequence:CCGGCCAGAGATGTTTGACCCTCATCTCGAGATGAGGGTCAAACATCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000771
CYP2C9 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 2, subfamily C, polypeptide 9
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434620    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000771.3-1558s21c1
Sequence:CCGGCATTATCCATCTTTCACTATCCTCGAGGATAGTGAAAGATGGATAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418357    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000771.3-1652s21c1
Sequence:CCCGACGGAGAGTTTCCTATGTTTCCTCGAGGAAACATAGGAAACTCTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000771.2-825s1c1
Sequence:CCGGGCACAACCAACCATCTGAATTCTCGAGAATTCAGATGGTTGGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000771.2-186s1c1
Sequence:CCGGCCCGGTGTTCACTCTGTATTTCTCGAGAAATACAGAGTGAACACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000771.2-1112s1c1
Sequence:CCGGCCTGTGACATTAAATTCAGAACTCGAGTTCTGAATTTAATGTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000771.2-679s1c1
Sequence:CCGGCCGGGAACTCACAACAAATTACTCGAGTAATTTGTTGTGAGTTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000771.2-1210s1c1
Sequence:CCGGCCAGAGATGTTTGACCCTCATCTCGAGATGAGGGTCAAACATCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks