EMAIL THIS PAGE TO A FRIEND

CYP2D6

cytochrome P450, family 2, subfamily D, polypeptide 6

67 Gene Product Result for
Synonyms: CPD6 CYP2D CYP2D7AP CYP2D7BP CYP2D7P2 CYP2D8P2 CYP2DL1 CYPIID6 P450-DB1 P450C2D P450DB1
Gene ID:
Human(1565) Summary: This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and is known to metabolize as many as 20% of commonly prescribed drugs. Its substrates include debrisoquine, an adrenergic-blocking drug; sparteine and propafenone, both anti-arrythmic drugs; and amitryptiline, an anti-depressant. The gene is highly polymorphic in the population; certain alleles result in the poor metabolizer phenotype, characterized by a decreased ability to metabolize the enzyme's substrates. The gene is located near two cytochrome P450 pseudogenes on chromosome 22q13.1. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
chicken(417981) cytochrome P450, family 2, subfamily D, polypeptide 6
domestic cat(100500743) cytochrome 2D6
sheep(100568286) cytochrome P450 2D6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0040 AQUA Peptide LLDLAQEGL[K] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000106 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000106 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000106 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU115661 MISSION® esiRNA esiRNA human CYP2D6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000106 Rosetta Predictions human pricing
NM_001025161 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000106 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00301879 predicted 1523
2 SASI_Hs02_00301880 predicted 1514
3 SASI_Hs02_00301881 predicted 1519
4 SASI_Hs01_00051268 predicted 1263
5 SASI_Hs01_00051269 predicted 1437
6 SASI_Hs01_00051270 predicted 1369
7 SASI_Hs01_00051271 predicted 1139
8 SASI_Hs01_00051272 predicted 1291
9 SASI_Hs01_00051273 predicted 942
10 SASI_Hs01_00051274 predicted 1150
11 SASI_Hs01_00051275 predicted 1147
12 SASI_Hs01_00051276 predicted 1226
13 SASI_Hs01_00051277 predicted 1238
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025161 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307387 predicted 1371
2 SASI_Hs02_00307388 predicted 1363
3 SASI_Hs02_00307389 predicted 1370
4 SASI_Hs01_00050722 predicted 1115
5 SASI_Hs01_00050723 predicted 1291
6 SASI_Hs01_00050724 predicted 1210
7 SASI_Hs01_00050725 predicted 985
8 SASI_Hs01_00050726 predicted 1138
9 SASI_Hs01_00050727 predicted 795
10 SASI_Hs01_00050728 predicted 998
11 SASI_Hs01_00050729 predicted 996
12 SASI_Hs01_00050730 predicted 1066
13 SASI_Hs01_00050731 predicted 1086
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000106
CYP2D6 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 2, subfamily D, polypeptide 6
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000106.4-611s21c1
Sequence:CCGGCCAACGGTCTCTTGGACAAAGCTCGAGCTTTGTCCAAGAGACCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000106.4-1222s21c1
Sequence:CCGGACATCCCGTGACATCGAAGTACTCGAGTACTTCGATGTCACGGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000106.4-1257s21c1
Sequence:CCGGCCCTAAGGGAACGACACTCATCTCGAGATGAGTGTCGTTCCCTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000106.4-1153s21c1
Sequence:CCGGTACACCACTGCCGTGATTCATCTCGAGATGAATCACGGCAGTGGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000106.4-944s21c1
Sequence:CCGGACCCTGAGAGCAGCTTCAATGCTCGAGCATTGAAGCTGCTCTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000106.3-250s1c1
Sequence:CCGGACCATACTGCTTCGACCAGTTCTCGAGAACTGGTCGAAGCAGTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000106.3-608s1c1
Sequence:CCGGCCCAACGGTCTCTTGGACAAACTCGAGTTTGTCCAAGAGACCGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000106.3-801s1c1
Sequence:CCGGGCAAGGTCCTACGCTTCCAAACTCGAGTTTGGAAGCGTAGGACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000106.3-1213s1c1
Sequence:CCGGCCATATGACATCCCGTGACATCTCGAGATGTCACGGGATGTCATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000106.3-1040s1c1
Sequence:CCGGCTCCTGCTCATGATCCTACATCTCGAGATGTAGGATCATGAGCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000106
CYP2D6 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 2, subfamily D, polypeptide 6
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000106.4-611s21c1
Sequence:CCGGCCAACGGTCTCTTGGACAAAGCTCGAGCTTTGTCCAAGAGACCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000106.4-1222s21c1
Sequence:CCGGACATCCCGTGACATCGAAGTACTCGAGTACTTCGATGTCACGGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000106.4-1257s21c1
Sequence:CCGGCCCTAAGGGAACGACACTCATCTCGAGATGAGTGTCGTTCCCTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000106.4-1153s21c1
Sequence:CCGGTACACCACTGCCGTGATTCATCTCGAGATGAATCACGGCAGTGGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000106.4-944s21c1
Sequence:CCGGACCCTGAGAGCAGCTTCAATGCTCGAGCATTGAAGCTGCTCTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000106.3-250s1c1
Sequence:CCGGACCATACTGCTTCGACCAGTTCTCGAGAACTGGTCGAAGCAGTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000106.3-608s1c1
Sequence:CCGGCCCAACGGTCTCTTGGACAAACTCGAGTTTGTCCAAGAGACCGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000106.3-801s1c1
Sequence:CCGGGCAAGGTCCTACGCTTCCAAACTCGAGTTTGGAAGCGTAGGACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000106.3-1213s1c1
Sequence:CCGGCCATATGACATCCCGTGACATCTCGAGATGTCACGGGATGTCATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000106.3-1040s1c1
Sequence:CCGGCTCCTGCTCATGATCCTACATCTCGAGATGTAGGATCATGAGCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000106
CYP2D6 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 2, subfamily D, polypeptide 6
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000106.4-611s21c1
Sequence:CCGGCCAACGGTCTCTTGGACAAAGCTCGAGCTTTGTCCAAGAGACCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000106.4-1222s21c1
Sequence:CCGGACATCCCGTGACATCGAAGTACTCGAGTACTTCGATGTCACGGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000106.4-1257s21c1
Sequence:CCGGCCCTAAGGGAACGACACTCATCTCGAGATGAGTGTCGTTCCCTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000106.4-1153s21c1
Sequence:CCGGTACACCACTGCCGTGATTCATCTCGAGATGAATCACGGCAGTGGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000106.4-944s21c1
Sequence:CCGGACCCTGAGAGCAGCTTCAATGCTCGAGCATTGAAGCTGCTCTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000106.3-250s1c1
Sequence:CCGGACCATACTGCTTCGACCAGTTCTCGAGAACTGGTCGAAGCAGTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000106.3-608s1c1
Sequence:CCGGCCCAACGGTCTCTTGGACAAACTCGAGTTTGTCCAAGAGACCGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000106.3-801s1c1
Sequence:CCGGGCAAGGTCCTACGCTTCCAAACTCGAGTTTGGAAGCGTAGGACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000106.3-1213s1c1
Sequence:CCGGCCATATGACATCCCGTGACATCTCGAGATGTCACGGGATGTCATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000106.3-1040s1c1
Sequence:CCGGCTCCTGCTCATGATCCTACATCTCGAGATGTAGGATCATGAGCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks