EMAIL THIS PAGE TO A FRIEND

CYP2D7P1

cytochrome P450, family 2, subfamily D, polypeptide 7 pseudogene 1

8 Gene Product Result for
Synonyms: CYP2D CYP2D7 CYP2D7AP CYP2D@ P450C2D P450DB1
Species: Human CYP2D7P1(1564)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0040 AQUA Peptide LLDLAQEGL[K] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001002910 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001002910 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001002910 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NR_002570 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_002570 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00376125 predicted 239
2 SASI_Hs02_00376126 predicted 994
3 SASI_Hs02_00376127 predicted 931
4 SASI_Hs02_00376128 predicted 1539
5 SASI_Hs02_00376129 predicted 1542
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001002910
CYP2D7P1 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 2, subfamily D, polypeptide 7 pseudogene 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002910.1-1009s1c1
Sequence:CCGGGTGGTGGGTAACCTGTTCCTTCTCGAGAAGGAACAGGTTACCCACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002910.1-1150s1c1
Sequence:CCGGGTCTGTCCAGTCCGTGTCCAACTCGAGTTGGACACGGACTGGACAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002910.1-999s1c1
Sequence:CCGGCCTGCGCATAGTGGTGGGTAACTCGAGTTACCCACCACTATGCGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002910.1-270s1c1
Sequence:CCGGCCAGAACACACCATACTGCTTCTCGAGAAGCAGTATGGTGTGTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002910.1-1603s1c1
Sequence:CCGGCACTCTCGTGTCGTCAGCTTTCTCGAGAAAGCTGACGACACGAGAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001002910
CYP2D7P1 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 2, subfamily D, polypeptide 7 pseudogene 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002910.1-1009s1c1
Sequence:CCGGGTGGTGGGTAACCTGTTCCTTCTCGAGAAGGAACAGGTTACCCACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002910.1-1150s1c1
Sequence:CCGGGTCTGTCCAGTCCGTGTCCAACTCGAGTTGGACACGGACTGGACAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002910.1-999s1c1
Sequence:CCGGCCTGCGCATAGTGGTGGGTAACTCGAGTTACCCACCACTATGCGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002910.1-270s1c1
Sequence:CCGGCCAGAACACACCATACTGCTTCTCGAGAAGCAGTATGGTGTGTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002910.1-1603s1c1
Sequence:CCGGCACTCTCGTGTCGTCAGCTTTCTCGAGAAAGCTGACGACACGAGAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001002910
CYP2D7P1 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 2, subfamily D, polypeptide 7 pseudogene 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002910.1-1009s1c1
Sequence:CCGGGTGGTGGGTAACCTGTTCCTTCTCGAGAAGGAACAGGTTACCCACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002910.1-1150s1c1
Sequence:CCGGGTCTGTCCAGTCCGTGTCCAACTCGAGTTGGACACGGACTGGACAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002910.1-999s1c1
Sequence:CCGGCCTGCGCATAGTGGTGGGTAACTCGAGTTACCCACCACTATGCGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002910.1-270s1c1
Sequence:CCGGCCAGAACACACCATACTGCTTCTCGAGAAGCAGTATGGTGTGTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002910.1-1603s1c1
Sequence:CCGGCACTCTCGTGTCGTCAGCTTTCTCGAGAAAGCTGACGACACGAGAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)