EMAIL THIS PAGE TO A FRIEND

CYP2E1

cytochrome P450, family 2, subfamily E, polypeptide 1

62 Gene Product Result for
Synonyms: CPE1 CYP2E P450-J P450C2E
UniProtKB ID: P05181, Q5VZD5, Q9UK47
Gene ID:
Human(1571) Summary: This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and is induced by ethanol, the diabetic state, and starvation. The enzyme metabolizes both endogenous substrates, such as ethanol, acetone, and acetal, as well as exogenous substrates including benzene, carbon tetrachloride, ethylene glycol, and nitrosamines which are premutagens found in cigarette smoke. Due to its many substrates, this enzyme may be involved in such varied processes as gluconeogenesis, hepatic cirrhosis, diabetes, and cancer. [provided by RefSeq, Jul 2008]
Mouse(13106) cytochrome P450, family 2, subfamily e, polypeptide 1
Rat(25086) cytochrome P450, family 2, subfamily e, polypeptide 1
dog(415128) cytochrome P450, family 2, subfamily E, polypeptide 1
cow(282213) cytochrome P450, family 2, subfamily E, polypeptide 1
Horse(100066422) cytochrome P450, family 2, subfamily E, polypeptide 1
domestic cat(554344) cytochrome P450 2E1
sheep(100568285) cytochrome P450, family 2, subfamily E, polypeptide 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Cell Lines

Product # Description Species Add to Cart
 
MTOXCE2E1 CypExpress 2E1 Cytochrome P450 human human pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0043 AQUA Peptide GYLIP[K] Escherichia coli O157:H7 EDL933, Pseudoalteromonas atlantica T6c, Yersinia pestis biovar Microtus str. 91001, human, mouse pricing
AQ0042 AQUA Peptide VIGPS[R] cow, dog, human, mouse, rat pricing
AQ0041 AQUA Peptide GDLPAFHAH[R] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021282 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021282 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021282 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000773 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000773 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000773 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000773 Rosetta Predictions human pricing
NM_031543 Rosetta Predictions rat pricing
NM_021282 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000773 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303202 predicted 1414
2 SASI_Hs01_00167618 predicted 1260
3 SASI_Hs01_00167619 predicted 1036
4 SASI_Hs01_00167620 predicted 393
5 SASI_Hs01_00167621 predicted 1019
6 SASI_Hs02_00303203 predicted 1442
7 SASI_Hs01_00167622 predicted 1300
8 SASI_Hs01_00167623 predicted 275
9 SASI_Hs01_00167624 predicted 895
10 SASI_Hs01_00167625 predicted 1284
11 SASI_Hs01_00167626 predicted 455
12 SASI_Hs01_00167627 predicted 1103
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031543 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089472 predicted 931
2 SASI_Rn01_00089473 predicted 561
3 SASI_Rn01_00089474 predicted 662
4 SASI_Rn01_00089475 predicted 428
5 SASI_Rn01_00089476 predicted 1223
6 SASI_Rn01_00089477 predicted 668
7 SASI_Rn01_00089478 predicted 261
8 SASI_Rn01_00089479 predicted 446
9 SASI_Rn02_00264715 predicted 957
10 SASI_Rn02_00264716 predicted 753
11 SASI_Rn01_00089471 predicted 1199
12 SASI_Rn01_00089480 predicted 1134
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021282 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105752 predicted 759
2 SASI_Mm01_00105754 predicted 680
3 SASI_Mm01_00105756 predicted 542
4 SASI_Mm01_00105757 predicted 1503
5 SASI_Mm01_00105758 predicted 852
6 SASI_Mm02_00325808 predicted 961
7 SASI_Mm01_00105759 predicted 1081
8 SASI_Mm02_00325809 predicted 268
9 SASI_Mm01_00105761 predicted 678
10 SASI_Mm02_00325810 predicted 883
11 SASI_Mm01_00105753 predicted 1435
12 SASI_Mm01_00105755 predicted 1459
13 SASI_Mm01_00105760 predicted 1275
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021282
CYP2E1 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 2, subfamily E, polypeptide 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021282.2-1039s21c1
Sequence:CCGGAGTCCGAGACAGGATGAATATCTCGAGATATTCATCCTGTCTCGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021282.2-171s21c1
Sequence:CCGGAGGATATTCCCAAGTCTTTAACTCGAGTTAAAGACTTGGGAATATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021282.2-1071s21c1
Sequence:CCGGACGCTGTAGTGCATGAGATTCCTCGAGGAATCTCATGCACTACAGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021282.2-681s21c1
Sequence:CCGGTTTCGGATTATCTACAATATCCTCGAGGATATTGTAGATAATCCGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021282.1-1604s1c1
Sequence:CCGGCCCATCATTATCCCTTACAAACTCGAGTTTGTAAGGGATAATGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021282.1-174s1c1
Sequence:CCGGCCATCTGGAAACAGATCTATACTCGAGTATAGATCTGTTTCCAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021282.1-1382s1c1
Sequence:CCGGAGTGACTATTTCAAGGCGTTTCTCGAGAAACGCCTTGAAATAGTCACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021282.1-1262s1c1
Sequence:CCGGCCCAAGGGTACAGTTGTAATTCTCGAGAATTACAACTGTACCCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021282.1-653s1c1
Sequence:CCGGGCGGATATTCTCTTCAACAAACTCGAGTTTGTTGAAGAGAATATCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021282
CYP2E1 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 2, subfamily E, polypeptide 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021282.2-1039s21c1
Sequence:CCGGAGTCCGAGACAGGATGAATATCTCGAGATATTCATCCTGTCTCGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021282.2-171s21c1
Sequence:CCGGAGGATATTCCCAAGTCTTTAACTCGAGTTAAAGACTTGGGAATATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021282.2-1071s21c1
Sequence:CCGGACGCTGTAGTGCATGAGATTCCTCGAGGAATCTCATGCACTACAGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021282.2-681s21c1
Sequence:CCGGTTTCGGATTATCTACAATATCCTCGAGGATATTGTAGATAATCCGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021282.1-1604s1c1
Sequence:CCGGCCCATCATTATCCCTTACAAACTCGAGTTTGTAAGGGATAATGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021282.1-174s1c1
Sequence:CCGGCCATCTGGAAACAGATCTATACTCGAGTATAGATCTGTTTCCAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021282.1-1382s1c1
Sequence:CCGGAGTGACTATTTCAAGGCGTTTCTCGAGAAACGCCTTGAAATAGTCACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021282.1-1262s1c1
Sequence:CCGGCCCAAGGGTACAGTTGTAATTCTCGAGAATTACAACTGTACCCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021282.1-653s1c1
Sequence:CCGGGCGGATATTCTCTTCAACAAACTCGAGTTTGTTGAAGAGAATATCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021282
CYP2E1 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 2, subfamily E, polypeptide 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021282.2-1039s21c1
Sequence:CCGGAGTCCGAGACAGGATGAATATCTCGAGATATTCATCCTGTCTCGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021282.2-171s21c1
Sequence:CCGGAGGATATTCCCAAGTCTTTAACTCGAGTTAAAGACTTGGGAATATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021282.2-1071s21c1
Sequence:CCGGACGCTGTAGTGCATGAGATTCCTCGAGGAATCTCATGCACTACAGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021282.2-681s21c1
Sequence:CCGGTTTCGGATTATCTACAATATCCTCGAGGATATTGTAGATAATCCGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021282.1-1604s1c1
Sequence:CCGGCCCATCATTATCCCTTACAAACTCGAGTTTGTAAGGGATAATGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021282.1-174s1c1
Sequence:CCGGCCATCTGGAAACAGATCTATACTCGAGTATAGATCTGTTTCCAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021282.1-1382s1c1
Sequence:CCGGAGTGACTATTTCAAGGCGTTTCTCGAGAAACGCCTTGAAATAGTCACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021282.1-1262s1c1
Sequence:CCGGCCCAAGGGTACAGTTGTAATTCTCGAGAATTACAACTGTACCCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021282.1-653s1c1
Sequence:CCGGGCGGATATTCTCTTCAACAAACTCGAGTTTGTTGAAGAGAATATCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000773
CYP2E1 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 2, subfamily E, polypeptide 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000773.2-617s1c1
Sequence:CCGGGAAGTTTCTAAGGCTGATGTACTCGAGTACATCAGCCTTAGAAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000773.2-1362s1c1
Sequence:CCGGGCTCGCATGGAGTTGTTTCTTCTCGAGAAGAAACAACTCCATGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000773.2-677s1c1
Sequence:CCGGGCTCCAGCTTTACAATAATTTCTCGAGAAATTATTGTAAAGCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000773.2-1304s1c1
Sequence:CCGGCAGTGACTATTTCAAGCCATTCTCGAGAATGGCTTGAAATAGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000773.2-880s1c1
Sequence:CCGGGCTTGTACACAATGGACGGTACTCGAGTACCGTCCATTGTGTACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000773
CYP2E1 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 2, subfamily E, polypeptide 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000773.2-617s1c1
Sequence:CCGGGAAGTTTCTAAGGCTGATGTACTCGAGTACATCAGCCTTAGAAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000773.2-1362s1c1
Sequence:CCGGGCTCGCATGGAGTTGTTTCTTCTCGAGAAGAAACAACTCCATGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000773.2-677s1c1
Sequence:CCGGGCTCCAGCTTTACAATAATTTCTCGAGAAATTATTGTAAAGCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000773.2-1304s1c1
Sequence:CCGGCAGTGACTATTTCAAGCCATTCTCGAGAATGGCTTGAAATAGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000773.2-880s1c1
Sequence:CCGGGCTTGTACACAATGGACGGTACTCGAGTACCGTCCATTGTGTACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000773
CYP2E1 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 2, subfamily E, polypeptide 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000773.2-617s1c1
Sequence:CCGGGAAGTTTCTAAGGCTGATGTACTCGAGTACATCAGCCTTAGAAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000773.2-1362s1c1
Sequence:CCGGGCTCGCATGGAGTTGTTTCTTCTCGAGAAGAAACAACTCCATGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000773.2-677s1c1
Sequence:CCGGGCTCCAGCTTTACAATAATTTCTCGAGAAATTATTGTAAAGCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000773.2-1304s1c1
Sequence:CCGGCAGTGACTATTTCAAGCCATTCTCGAGAATGGCTTGAAATAGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000773.2-880s1c1
Sequence:CCGGGCTTGTACACAATGGACGGTACTCGAGTACCGTCCATTGTGTACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks