EMAIL THIS PAGE TO A FRIEND

CYP2F1

cytochrome P450, family 2, subfamily F, polypeptide 1

19 Gene Product Result for
Synonyms: C2F1 CYP2F
Species: Human CYP2F1(1572)
Gene ID:
Human(1572) Summary: This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and is known to dehydrogenate 3-methylindole, an endogenous toxin derived from the fermentation of tryptophan, as well as xenobiotic substrates such as naphthalene and ethoxycoumarin. This gene is part of a large cluster of cytochrome P450 genes from the CYP2A, CYP2B and CYP2F subfamilies on chromosome 19q. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000774 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000774 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000774 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000774 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000774 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169863 predicted 986
2 SASI_Hs01_00169864 predicted 1298
3 SASI_Hs01_00169865 predicted 196
4 SASI_Hs01_00169866 predicted 840
5 SASI_Hs01_00169867 predicted 470
6 SASI_Hs01_00169868 predicted 646
7 SASI_Hs02_00303204 predicted 641
8 SASI_Hs01_00169869 predicted 564
9 SASI_Hs01_00169870 predicted 984
10 SASI_Hs01_00169871 predicted 617
11 SASI_Hs01_00169872 predicted 746
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000774
CYP2F1 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 2, subfamily F, polypeptide 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000774.3-653s1c1
Sequence:CCGGCCGCCTTATCAATGACAACTTCTCGAGAAGTTGTCATTGATAAGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000774.3-1214s1c1
Sequence:CCGGCGATGTCATCACCCTCCTTAACTCGAGTTAAGGAGGGTGATGACATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000774.3-917s1c1
Sequence:CCGGCCTGCTGATGACCACACATAACTCGAGTTATGTGTGGTCATCAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000774.3-439s1c1
Sequence:CCGGCTATCCAGATTCTACGGAATTCTCGAGAATTCCGTAGAATCTGGATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000774.3-641s1c1
Sequence:CCGGGCTCACCATTATCCGCCTTATCTCGAGATAAGGCGGATAATGGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000774.3-695s21c1
Sequence:CCGGGGGCGAGTTGTACGACATCTTCTCGAGAAGATGTCGTACAACTCGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000774.3-207s21c1
Sequence:CCGGATGCTGACTTCTCTCACTAAGCTCGAGCTTAGTGAGAGAAGTCAGCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000774.3-116s21c1
Sequence:CCGGGACCCTAAGCTCAAGAGATAACTCGAGTTATCTCTTGAGCTTAGGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000774.3-571s21c1
Sequence:CCGGGTCGCTCAGTGTCCAACATTACTCGAGTAATGTTGGACACTGAGCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000774
CYP2F1 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 2, subfamily F, polypeptide 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000774.3-653s1c1
Sequence:CCGGCCGCCTTATCAATGACAACTTCTCGAGAAGTTGTCATTGATAAGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000774.3-1214s1c1
Sequence:CCGGCGATGTCATCACCCTCCTTAACTCGAGTTAAGGAGGGTGATGACATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000774.3-917s1c1
Sequence:CCGGCCTGCTGATGACCACACATAACTCGAGTTATGTGTGGTCATCAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000774.3-439s1c1
Sequence:CCGGCTATCCAGATTCTACGGAATTCTCGAGAATTCCGTAGAATCTGGATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000774.3-641s1c1
Sequence:CCGGGCTCACCATTATCCGCCTTATCTCGAGATAAGGCGGATAATGGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000774.3-695s21c1
Sequence:CCGGGGGCGAGTTGTACGACATCTTCTCGAGAAGATGTCGTACAACTCGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000774.3-207s21c1
Sequence:CCGGATGCTGACTTCTCTCACTAAGCTCGAGCTTAGTGAGAGAAGTCAGCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000774.3-116s21c1
Sequence:CCGGGACCCTAAGCTCAAGAGATAACTCGAGTTATCTCTTGAGCTTAGGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000774.3-571s21c1
Sequence:CCGGGTCGCTCAGTGTCCAACATTACTCGAGTAATGTTGGACACTGAGCGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000774
CYP2F1 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 2, subfamily F, polypeptide 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000774.3-653s1c1
Sequence:CCGGCCGCCTTATCAATGACAACTTCTCGAGAAGTTGTCATTGATAAGGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000774.3-1214s1c1
Sequence:CCGGCGATGTCATCACCCTCCTTAACTCGAGTTAAGGAGGGTGATGACATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000774.3-917s1c1
Sequence:CCGGCCTGCTGATGACCACACATAACTCGAGTTATGTGTGGTCATCAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000774.3-439s1c1
Sequence:CCGGCTATCCAGATTCTACGGAATTCTCGAGAATTCCGTAGAATCTGGATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000774.3-641s1c1
Sequence:CCGGGCTCACCATTATCCGCCTTATCTCGAGATAAGGCGGATAATGGTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000774.3-695s21c1
Sequence:CCGGGGGCGAGTTGTACGACATCTTCTCGAGAAGATGTCGTACAACTCGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000774.3-207s21c1
Sequence:CCGGATGCTGACTTCTCTCACTAAGCTCGAGCTTAGTGAGAGAAGTCAGCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000774.3-116s21c1
Sequence:CCGGGACCCTAAGCTCAAGAGATAACTCGAGTTATCTCTTGAGCTTAGGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000774.3-571s21c1
Sequence:CCGGGTCGCTCAGTGTCCAACATTACTCGAGTAATGTTGGACACTGAGCGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)