EMAIL THIS PAGE TO A FRIEND

CYP2J2

cytochrome P450, family 2, subfamily J, polypeptide 2

Synonyms: CPJ2
UniProtKB ID: P51589
Gene ID:
Human(1573) Summary: This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and is thought to be the predominant enzyme responsible for epoxidation of endogenous arachidonic acid in cardiac tissue. [provided by RefSeq, Jul 2008]
chicken(424678) cytochrome P450, family 2, subfamily J, polypeptide 2
cow(510406) cytochrome P450, family 2, subfamily J, polypeptide 2
dog(610195) cytochrome P450, family 2, subfamily J, polypeptide 2
23 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000775 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000775 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000775 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000775 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000775 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079130 predicted 1386
2 SASI_Hs01_00079131 predicted 1257
3 SASI_Hs01_00079132 predicted 1285
4 SASI_Hs01_00079133 predicted 1307
5 SASI_Hs01_00079134 predicted 652
6 SASI_Hs01_00079135 predicted 408
7 SASI_Hs01_00079136 predicted 650
8 SASI_Hs01_00079137 predicted 1196
9 SASI_Hs01_00079138 predicted 733
10 SASI_Hs02_00303205 predicted 695
11 SASI_Hs01_00079139 predicted 1110
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000775
VALIDATED
CYP2J2 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 2, subfamily J, polypeptide 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000775.2-543s1c1
Sequence:CCGGCCTCATTTCAAGATCAACAATCTCGAGATTGTTGATCTTGAAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000775.2-1112s1c1
Sequence:CCGGGCAGAGAATGGGCAACATCATCTCGAGATGATGTTGCCCATTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000775.2-1365s1c1
Sequence:CCGGGCCAGGACTGAGCTGTTTATTCTCGAGAATAAACAGCTCAGTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000775.2-353s1c1
Sequence:CCGGGCGAGAACATATCTTTAAGAACTCGAGTTCTTAAAGATATGTTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000775.2-1445s1c1
Sequence:CCGGCCTGAAGTTTAGAATGGGTATCTCGAGATACCCATTCTAAACTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000775.2-1497s21c1
Sequence:CCGGGCTGTTCCTCAGGTGTAATATCTCGAGATATTACACCTGAGGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432678    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000775.2-1671s21c1
Sequence:CCGGTCTACTGTCTCGTCCGAATTACTCGAGTAATTCGGACGAGACAGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000775.2-963s21c1
Sequence:CCGGCTGCGATGGGCTCTGCTTTATCTCGAGATAAAGCAGAGCCCATCGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000775
VALIDATED
CYP2J2 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 2, subfamily J, polypeptide 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000775.2-543s1c1
Sequence:CCGGCCTCATTTCAAGATCAACAATCTCGAGATTGTTGATCTTGAAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000775.2-1112s1c1
Sequence:CCGGGCAGAGAATGGGCAACATCATCTCGAGATGATGTTGCCCATTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000775.2-1365s1c1
Sequence:CCGGGCCAGGACTGAGCTGTTTATTCTCGAGAATAAACAGCTCAGTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000775.2-353s1c1
Sequence:CCGGGCGAGAACATATCTTTAAGAACTCGAGTTCTTAAAGATATGTTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000775.2-1445s1c1
Sequence:CCGGCCTGAAGTTTAGAATGGGTATCTCGAGATACCCATTCTAAACTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000775.2-1497s21c1
Sequence:CCGGGCTGTTCCTCAGGTGTAATATCTCGAGATATTACACCTGAGGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432678    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000775.2-1671s21c1
Sequence:CCGGTCTACTGTCTCGTCCGAATTACTCGAGTAATTCGGACGAGACAGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000775.2-963s21c1
Sequence:CCGGCTGCGATGGGCTCTGCTTTATCTCGAGATAAAGCAGAGCCCATCGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000775
VALIDATED
CYP2J2 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 2, subfamily J, polypeptide 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000775.2-543s1c1
Sequence:CCGGCCTCATTTCAAGATCAACAATCTCGAGATTGTTGATCTTGAAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000775.2-1112s1c1
Sequence:CCGGGCAGAGAATGGGCAACATCATCTCGAGATGATGTTGCCCATTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000775.2-1365s1c1
Sequence:CCGGGCCAGGACTGAGCTGTTTATTCTCGAGAATAAACAGCTCAGTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000775.2-353s1c1
Sequence:CCGGGCGAGAACATATCTTTAAGAACTCGAGTTCTTAAAGATATGTTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000775.2-1445s1c1
Sequence:CCGGCCTGAAGTTTAGAATGGGTATCTCGAGATACCCATTCTAAACTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000775.2-1497s21c1
Sequence:CCGGGCTGTTCCTCAGGTGTAATATCTCGAGATATTACACCTGAGGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432678    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000775.2-1671s21c1
Sequence:CCGGTCTACTGTCTCGTCCGAATTACTCGAGTAATTCGGACGAGACAGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000775.2-963s21c1
Sequence:CCGGCTGCGATGGGCTCTGCTTTATCTCGAGATAAAGCAGAGCCCATCGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks