EMAIL THIS PAGE TO A FRIEND

CYP2R1

cytochrome P450, family 2, subfamily R, polypeptide 1

62 Gene Product Result for
UniProtKB ID: Q6VVX0, Q2M3H3, Q5RT65
Gene ID:
Human(120227) Summary: This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This enzyme is a microsomal vitamin D hydroxylase that converts vitamin D into the active ligand for the vitamin D receptor. A mutation in this gene has been associated with selective 25-hydroxyvitamin D deficiency. [provided by RefSeq, Jul 2008]
Mouse(244209) cytochrome P450, family 2, subfamily r, polypeptide 1
Rat(361631) cytochrome P450, family 2, subfamily r, polypeptide 1
Zebrafish(563369) cytochrome P450, family 2, subfamily R, polypeptide 1
cow(541302) cytochrome P450, family 2, subfamily R, polypeptide 1
dog(612993) cytochrome P450, family 2, subfamily R, polypeptide 1
chicken(423065) cytochrome P450, family 2, subfamily R, polypeptide 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177382 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177382 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177382 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024514 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024514 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024514 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024514 Rosetta Predictions human pricing
NM_001108499 Rosetta Predictions rat pricing
XM_341909 Rosetta Predictions rat pricing
NM_177382 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024514 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356785 predicted 980
2 SASI_Hs01_00044110 predicted 627
3 SASI_Hs01_00044111 predicted 287
4 SASI_Hs01_00044112 predicted 526
5 SASI_Hs01_00044114 predicted 560
6 SASI_Hs01_00044115 predicted 367
7 SASI_Hs01_00044117 predicted 722
8 SASI_Hs01_00044119 predicted 1248
9 SASI_Hs02_00356786 predicted 545
10 SASI_Hs02_00356787 predicted 668
11 SASI_Hs01_00044113 predicted 233
12 SASI_Hs01_00044116 predicted 220
13 SASI_Hs01_00044118 predicted 229
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108499 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239249 predicted 737
2 SASI_Rn02_00239250 predicted 557
3 SASI_Rn02_00239251 predicted 444
4 SASI_Rn02_00239252 predicted 733
5 SASI_Rn02_00239253 predicted 555
6 SASI_Rn02_00239254 predicted 365
7 SASI_Rn02_00239255 predicted 568
8 SASI_Rn02_00239256 predicted 372
9 SASI_Rn02_00239257 predicted 624
10 SASI_Rn02_00239258 predicted 533
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341909 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00155009 predicted 889
2 SASI_Rn01_00155010 predicted 910
3 SASI_Rn01_00155011 predicted 672
4 SASI_Rn01_00155012 predicted 1271
5 SASI_Rn01_00155013 predicted 1262
6 SASI_Rn01_00155014 predicted 617
7 SASI_Rn01_00155015 predicted 1076
8 SASI_Rn01_00155016 predicted 1330
9 SASI_Rn01_00155017 predicted 310
10 SASI_Rn01_00155018 predicted 1337
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177382 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055353 predicted 800
2 SASI_Mm01_00055354 predicted 613
3 SASI_Mm01_00055355 predicted 1214
4 SASI_Mm01_00055357 predicted 1197
5 SASI_Mm01_00055358 predicted 557
6 SASI_Mm01_00055359 predicted 758
7 SASI_Mm01_00055360 predicted 379
8 SASI_Mm01_00055361 predicted 1270
9 SASI_Mm02_00347558 predicted 850
10 SASI_Mm01_00055362 predicted 1247
11 SASI_Mm01_00055356 predicted 826
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177382
CYP2R1 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 2, subfamily R, polypeptide 1
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177382.3-685s1c1
Sequence:CCGGGCTCCAGTCTTCCTTTATAATCTCGAGATTATAAAGGAAGACTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177382.3-263s1c1
Sequence:CCGGGCATATCAACTGTCGTTCTAACTCGAGTTAGAACGACAGTTGATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174385    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177382.3-1411s1c1
Sequence:CCGGCTTCAGCAATTTCATTTGCATCTCGAGATGCAAATGAAATTGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177382.3-380s1c1
Sequence:CCGGGAGGCTTACTCAATTCCAGATCTCGAGATCTGGAATTGAGTAAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177382.3-549s1c1
Sequence:CCGGCCTCAAGCAACTGATAACAAACTCGAGTTTGTTATCAGTTGCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194000    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177382.3-248s1c1
Sequence:CCGGGTTTAGATCTTGGAGGCATATCTCGAGATATGCCTCCAAGATCTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177382.3-352s1c1
Sequence:CCGGCCTTTGTTCATGAAGATGACACTCGAGTGTCATCTTCATGAACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177382.3-1435s1c1
Sequence:CCGGCCACATGAACTAGTTCCAAATCTCGAGATTTGGAACTAGTTCATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215497    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177382.3-811s1c1
Sequence:CCGGGTCAATAGAAAGCCTCATTTACTCGAGTAAATGAGGCTTTCTATTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177382.3-990s1c1
Sequence:CCGGCATGGCCCTTTATCCTAATATCTCGAGATATTAGGATAAAGGGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177382.3-1270s21c1
Sequence:CCGGATGTTCTATCCTGAGCGATTTCTCGAGAAATCGCTCAGGATAGAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177382.3-434s21c1
Sequence:CCGCCTGTTAACAGCTTTCATTATTCTCGAGAATAATGAAAGCTGTTAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177382.3-1172s21c1
Sequence:CCGGATGCAGTTGTACGTGGCTATTCTCGAGAATAGCCACGTACAACTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177382.3-571s21c1
Sequence:CCGGGCTGTTTCAAACATAACTAACCTCGAGGTTAGTTATGTTTGAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177382
CYP2R1 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 2, subfamily R, polypeptide 1
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177382.3-685s1c1
Sequence:CCGGGCTCCAGTCTTCCTTTATAATCTCGAGATTATAAAGGAAGACTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177382.3-263s1c1
Sequence:CCGGGCATATCAACTGTCGTTCTAACTCGAGTTAGAACGACAGTTGATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174385    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177382.3-1411s1c1
Sequence:CCGGCTTCAGCAATTTCATTTGCATCTCGAGATGCAAATGAAATTGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177382.3-380s1c1
Sequence:CCGGGAGGCTTACTCAATTCCAGATCTCGAGATCTGGAATTGAGTAAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177382.3-549s1c1
Sequence:CCGGCCTCAAGCAACTGATAACAAACTCGAGTTTGTTATCAGTTGCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194000    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177382.3-248s1c1
Sequence:CCGGGTTTAGATCTTGGAGGCATATCTCGAGATATGCCTCCAAGATCTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177382.3-352s1c1
Sequence:CCGGCCTTTGTTCATGAAGATGACACTCGAGTGTCATCTTCATGAACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177382.3-1435s1c1
Sequence:CCGGCCACATGAACTAGTTCCAAATCTCGAGATTTGGAACTAGTTCATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215497    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177382.3-811s1c1
Sequence:CCGGGTCAATAGAAAGCCTCATTTACTCGAGTAAATGAGGCTTTCTATTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177382.3-990s1c1
Sequence:CCGGCATGGCCCTTTATCCTAATATCTCGAGATATTAGGATAAAGGGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177382.3-1270s21c1
Sequence:CCGGATGTTCTATCCTGAGCGATTTCTCGAGAAATCGCTCAGGATAGAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177382.3-434s21c1
Sequence:CCGCCTGTTAACAGCTTTCATTATTCTCGAGAATAATGAAAGCTGTTAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177382.3-1172s21c1
Sequence:CCGGATGCAGTTGTACGTGGCTATTCTCGAGAATAGCCACGTACAACTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177382.3-571s21c1
Sequence:CCGGGCTGTTTCAAACATAACTAACCTCGAGGTTAGTTATGTTTGAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177382
CYP2R1 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 2, subfamily R, polypeptide 1
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177382.3-685s1c1
Sequence:CCGGGCTCCAGTCTTCCTTTATAATCTCGAGATTATAAAGGAAGACTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177382.3-263s1c1
Sequence:CCGGGCATATCAACTGTCGTTCTAACTCGAGTTAGAACGACAGTTGATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174385    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177382.3-1411s1c1
Sequence:CCGGCTTCAGCAATTTCATTTGCATCTCGAGATGCAAATGAAATTGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177382.3-380s1c1
Sequence:CCGGGAGGCTTACTCAATTCCAGATCTCGAGATCTGGAATTGAGTAAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177382.3-549s1c1
Sequence:CCGGCCTCAAGCAACTGATAACAAACTCGAGTTTGTTATCAGTTGCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194000    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177382.3-248s1c1
Sequence:CCGGGTTTAGATCTTGGAGGCATATCTCGAGATATGCCTCCAAGATCTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177382.3-352s1c1
Sequence:CCGGCCTTTGTTCATGAAGATGACACTCGAGTGTCATCTTCATGAACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177382.3-1435s1c1
Sequence:CCGGCCACATGAACTAGTTCCAAATCTCGAGATTTGGAACTAGTTCATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215497    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177382.3-811s1c1
Sequence:CCGGGTCAATAGAAAGCCTCATTTACTCGAGTAAATGAGGCTTTCTATTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177382.3-990s1c1
Sequence:CCGGCATGGCCCTTTATCCTAATATCTCGAGATATTAGGATAAAGGGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177382.3-1270s21c1
Sequence:CCGGATGTTCTATCCTGAGCGATTTCTCGAGAAATCGCTCAGGATAGAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177382.3-434s21c1
Sequence:CCGCCTGTTAACAGCTTTCATTATTCTCGAGAATAATGAAAGCTGTTAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177382.3-1172s21c1
Sequence:CCGGATGCAGTTGTACGTGGCTATTCTCGAGAATAGCCACGTACAACTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177382.3-571s21c1
Sequence:CCGGGCTGTTTCAAACATAACTAACCTCGAGGTTAGTTATGTTTGAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024514
VALIDATED
CYP2R1 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 2, subfamily R, polypeptide 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024514.3-135s1c1
Sequence:CCGGGCTGCCATTTATCGGCAACATCTCGAGATGTTGCCGATAAATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024514.3-870s1c1
Sequence:CCGGCCCATCATCTACTTTCTCCAACTCGAGTTGGAGAAAGTAGATGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024514.3-293s1c1
Sequence:CCGGGCCTTGTTCATCAAAGCGAAACTCGAGTTTCGCTTTGATGAACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_024514.3-670s1c1
Sequence:CCGGGCCTCAGTCTTCTTGTATAATCTCGAGATTATACAAGAAGACTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_024514.3-1168s1c1
Sequence:CCGGCGTGGTTATTCCATTCCTAAACTCGAGTTTAGGAATGGAATAACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024514.4-397s21c1
Sequence:CCGGTGGGTTGATCACAGACGATTACTCGAGTAATCGTCTGTGATCAACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024514.4-1046s21c1
Sequence:CCGGAGCCTTCTTGGGACGACAAATCTCGAGATTTGTCGTCCCAAGAAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024514
VALIDATED
CYP2R1 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 2, subfamily R, polypeptide 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024514.3-135s1c1
Sequence:CCGGGCTGCCATTTATCGGCAACATCTCGAGATGTTGCCGATAAATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024514.3-870s1c1
Sequence:CCGGCCCATCATCTACTTTCTCCAACTCGAGTTGGAGAAAGTAGATGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024514.3-293s1c1
Sequence:CCGGGCCTTGTTCATCAAAGCGAAACTCGAGTTTCGCTTTGATGAACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_024514.3-670s1c1
Sequence:CCGGGCCTCAGTCTTCTTGTATAATCTCGAGATTATACAAGAAGACTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_024514.3-1168s1c1
Sequence:CCGGCGTGGTTATTCCATTCCTAAACTCGAGTTTAGGAATGGAATAACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024514.4-397s21c1
Sequence:CCGGTGGGTTGATCACAGACGATTACTCGAGTAATCGTCTGTGATCAACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024514.4-1046s21c1
Sequence:CCGGAGCCTTCTTGGGACGACAAATCTCGAGATTTGTCGTCCCAAGAAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024514
VALIDATED
CYP2R1 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 2, subfamily R, polypeptide 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024514.3-135s1c1
Sequence:CCGGGCTGCCATTTATCGGCAACATCTCGAGATGTTGCCGATAAATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024514.3-870s1c1
Sequence:CCGGCCCATCATCTACTTTCTCCAACTCGAGTTGGAGAAAGTAGATGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024514.3-293s1c1
Sequence:CCGGGCCTTGTTCATCAAAGCGAAACTCGAGTTTCGCTTTGATGAACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_024514.3-670s1c1
Sequence:CCGGGCCTCAGTCTTCTTGTATAATCTCGAGATTATACAAGAAGACTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_024514.3-1168s1c1
Sequence:CCGGCGTGGTTATTCCATTCCTAAACTCGAGTTTAGGAATGGAATAACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024514.4-397s21c1
Sequence:CCGGTGGGTTGATCACAGACGATTACTCGAGTAATCGTCTGTGATCAACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024514.4-1046s21c1
Sequence:CCGGAGCCTTCTTGGGACGACAAATCTCGAGATTTGTCGTCCCAAGAAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks