EMAIL THIS PAGE TO A FRIEND

CYP2S1

cytochrome P450, family 2, subfamily S, polypeptide 1

UniProtKB ID: Q96SQ9, Q9BZ66
Gene ID:
Human(29785) Summary: This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum. In rodents, the homologous protein has been shown to metabolize certain carcinogens; however, the specific function of the human protein has not been determined. [provided by RefSeq, Jul 2008]
Mouse(74134) cytochrome P450, family 2, subfamily s, polypeptide 1
Rat(308445) cytochrome P450, family 2, subfamily s, polypeptide 1
cow(514971) cytochrome P450, family 2, subfamily S, polypeptide 1
dog(484491) cytochrome P450, family 2, subfamily S, polypeptide 1
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028775 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028775 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028775 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_030622 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030622 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030622 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030622 Rosetta Predictions human pricing
NM_001107495 Rosetta Predictions rat pricing
NM_028775 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030622 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200453 predicted 1839
2 SASI_Hs01_00200455 predicted 1925
3 SASI_Hs02_00358177 predicted 1666
4 SASI_Hs01_00200456 predicted 1797
5 SASI_Hs01_00200457 predicted 1279
6 SASI_Hs01_00200458 predicted 1637
7 SASI_Hs01_00200459 predicted 986
8 SASI_Hs01_00200461 predicted 1914
9 SASI_Hs01_00200462 predicted 1632
10 SASI_Hs02_00358178 predicted 1955
11 SASI_Hs01_00200454 predicted 922
12 SASI_Hs01_00200460 predicted 1791
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107495 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229395 predicted 382
2 SASI_Rn02_00229396 predicted 1003
3 SASI_Rn02_00229397 predicted 886
4 SASI_Rn02_00229398 predicted 378
5 SASI_Rn02_00229399 predicted 902
6 SASI_Rn02_00229400 predicted 381
7 SASI_Rn02_00229401 predicted 620
8 SASI_Rn02_00229402 predicted 624
9 SASI_Rn02_00229403 predicted 948
10 SASI_Rn02_00229404 predicted 918
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028775 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161930 predicted 1619
2 SASI_Mm01_00161931 predicted 1588
3 SASI_Mm01_00161932 predicted 1283
4 SASI_Mm01_00161933 predicted 316
5 SASI_Mm01_00161934 predicted 860
6 SASI_Mm01_00161935 predicted 1285
7 SASI_Mm01_00161936 predicted 878
8 SASI_Mm01_00161938 predicted 357
9 SASI_Mm01_00161939 predicted 769
10 SASI_Mm02_00334382 predicted 1607
11 SASI_Mm01_00161937 predicted 1211
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028775
VALIDATED
CYP2S1 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 2, subfamily S, polypeptide 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028775.3-82s21c1
Sequence:CCGGGCTGCTGTCTCTGACGCTATTCTCGAGAATAGCGTCAGAGACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028775.3-767s21c1
Sequence:CCGGGCCTTCACTATCCAGCAGGTACTCGAGTACCTGCTGGATAGTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028775.3-599s21c1
Sequence:CCGGCGTTTGCCCTATGACGATAAACTCGAGTTTATCGTCATAGGGCAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028775.3-204s21c1
Sequence:CCGGTGCGGCTAAGTAAGAAGTATGCTCGAGCATACTTCTTACTTAGCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028775.3-905s21c1
Sequence:CCGGTTGCTGATGACGGTCACATACCTCGAGGTATGTGACCGTCATCAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363613    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028775.3-2288s21c1
Sequence:CCGGCCAACAAATGTTCCCAAATATCTCGAGATATTTGGGAACATTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126644    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028775.2-2288s1c1
Sequence:CCGGCCAACAAATGTTCCCAAATATCTCGAGATATTTGGGAACATTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028775.2-561s1c1
Sequence:CCGGCCACCTCTAATGTCGTCTGTTCTCGAGAACAGACGACATTAGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028775.2-599s1c1
Sequence:CCGGCGTTTGCCCTATGACGATAAACTCGAGTTTATCGTCATAGGGCAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028775.2-767s1c1
Sequence:CCGGGCCTTCACTATCCAGCAGGTACTCGAGTACCTGCTGGATAGTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028775.2-582s1c1
Sequence:CCGGCCCTTGTCTTTGGCATCCGTTCTCGAGAACGGATGCCAAAGACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028775
VALIDATED
CYP2S1 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 2, subfamily S, polypeptide 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028775.3-82s21c1
Sequence:CCGGGCTGCTGTCTCTGACGCTATTCTCGAGAATAGCGTCAGAGACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028775.3-767s21c1
Sequence:CCGGGCCTTCACTATCCAGCAGGTACTCGAGTACCTGCTGGATAGTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028775.3-599s21c1
Sequence:CCGGCGTTTGCCCTATGACGATAAACTCGAGTTTATCGTCATAGGGCAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028775.3-204s21c1
Sequence:CCGGTGCGGCTAAGTAAGAAGTATGCTCGAGCATACTTCTTACTTAGCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028775.3-905s21c1
Sequence:CCGGTTGCTGATGACGGTCACATACCTCGAGGTATGTGACCGTCATCAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363613    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028775.3-2288s21c1
Sequence:CCGGCCAACAAATGTTCCCAAATATCTCGAGATATTTGGGAACATTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126644    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028775.2-2288s1c1
Sequence:CCGGCCAACAAATGTTCCCAAATATCTCGAGATATTTGGGAACATTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028775.2-561s1c1
Sequence:CCGGCCACCTCTAATGTCGTCTGTTCTCGAGAACAGACGACATTAGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028775.2-599s1c1
Sequence:CCGGCGTTTGCCCTATGACGATAAACTCGAGTTTATCGTCATAGGGCAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028775.2-767s1c1
Sequence:CCGGGCCTTCACTATCCAGCAGGTACTCGAGTACCTGCTGGATAGTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028775.2-582s1c1
Sequence:CCGGCCCTTGTCTTTGGCATCCGTTCTCGAGAACGGATGCCAAAGACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028775
VALIDATED
CYP2S1 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 2, subfamily S, polypeptide 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028775.3-82s21c1
Sequence:CCGGGCTGCTGTCTCTGACGCTATTCTCGAGAATAGCGTCAGAGACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028775.3-767s21c1
Sequence:CCGGGCCTTCACTATCCAGCAGGTACTCGAGTACCTGCTGGATAGTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028775.3-599s21c1
Sequence:CCGGCGTTTGCCCTATGACGATAAACTCGAGTTTATCGTCATAGGGCAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028775.3-204s21c1
Sequence:CCGGTGCGGCTAAGTAAGAAGTATGCTCGAGCATACTTCTTACTTAGCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028775.3-905s21c1
Sequence:CCGGTTGCTGATGACGGTCACATACCTCGAGGTATGTGACCGTCATCAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363613    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028775.3-2288s21c1
Sequence:CCGGCCAACAAATGTTCCCAAATATCTCGAGATATTTGGGAACATTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126644    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028775.2-2288s1c1
Sequence:CCGGCCAACAAATGTTCCCAAATATCTCGAGATATTTGGGAACATTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028775.2-561s1c1
Sequence:CCGGCCACCTCTAATGTCGTCTGTTCTCGAGAACAGACGACATTAGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028775.2-599s1c1
Sequence:CCGGCGTTTGCCCTATGACGATAAACTCGAGTTTATCGTCATAGGGCAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028775.2-767s1c1
Sequence:CCGGGCCTTCACTATCCAGCAGGTACTCGAGTACCTGCTGGATAGTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028775.2-582s1c1
Sequence:CCGGCCCTTGTCTTTGGCATCCGTTCTCGAGAACGGATGCCAAAGACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030622
CYP2S1 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 2, subfamily S, polypeptide 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000149759    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030622.6-2313s1c1
Sequence:CCGGGCGATTATGCACAGAGACTTTCTCGAGAAAGTCTCTGTGCATAATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030622.6-1004s1c1
Sequence:CCGGCTCCTGATGAAATACCCTCATCTCGAGATGAGGGTATTTCATCAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030622.6-439s1c1
Sequence:CCGGGAAGTTTACCATGCTTGCTCTCTCGAGAGAGCAAGCATGGTAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030622.6-1006s1c1
Sequence:CCGGCCTGATGAAATACCCTCATGTCTCGAGACATGAGGGTATTTCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030622
CYP2S1 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 2, subfamily S, polypeptide 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000149759    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030622.6-2313s1c1
Sequence:CCGGGCGATTATGCACAGAGACTTTCTCGAGAAAGTCTCTGTGCATAATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030622.6-1004s1c1
Sequence:CCGGCTCCTGATGAAATACCCTCATCTCGAGATGAGGGTATTTCATCAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030622.6-439s1c1
Sequence:CCGGGAAGTTTACCATGCTTGCTCTCTCGAGAGAGCAAGCATGGTAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030622.6-1006s1c1
Sequence:CCGGCCTGATGAAATACCCTCATGTCTCGAGACATGAGGGTATTTCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030622
CYP2S1 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 2, subfamily S, polypeptide 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000149759    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030622.6-2313s1c1
Sequence:CCGGGCGATTATGCACAGAGACTTTCTCGAGAAAGTCTCTGTGCATAATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030622.6-1004s1c1
Sequence:CCGGCTCCTGATGAAATACCCTCATCTCGAGATGAGGGTATTTCATCAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030622.6-439s1c1
Sequence:CCGGGAAGTTTACCATGCTTGCTCTCTCGAGAGAGCAAGCATGGTAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030622.6-1006s1c1
Sequence:CCGGCCTGATGAAATACCCTCATGTCTCGAGACATGAGGGTATTTCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks