EMAIL THIS PAGE TO A FRIEND

CYP2U1

cytochrome P450, family 2, subfamily U, polypeptide 1

63 Gene Product Result for
Synonyms: P450TEC SPG49 SPG56
UniProtKB ID: Q7Z449, B2RMV7, Q96EQ6
Gene ID:
Human(113612) Summary: This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This enzyme is a hydroxylase that metabolizes arachidonic acid, docosahexaenoic acid, and other long chain fatty acids. [provided by RefSeq, Jul 2008]
Mouse(71519) cytochrome P450, family 2, subfamily u, polypeptide 1
Rat(310848) cytochrome P450, family 2, subfamily u, polypeptide 1
Zebrafish(556280) cytochrome P450, family 2, subfamily U, polypeptide 1
cow(535227) cytochrome P450, family 2, subfamily U, polypeptide 1
dog(100685915) cytochrome P450, family 2, subfamily U, polypeptide 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183075 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_183075 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_183075 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027816 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027816 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027816 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU172661 MISSION® esiRNA esiRNA targeting mouse Cyp2u1 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_183075 Rosetta Predictions human pricing
NM_001024779 Rosetta Predictions rat pricing
NM_027816 Rosetta Predictions mouse pricing
XM_131188 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183075 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132869 predicted 869
2 SASI_Hs01_00132870 predicted 854
3 SASI_Hs01_00132872 predicted 893
4 SASI_Hs01_00132873 predicted 1459
5 SASI_Hs01_00132874 predicted 1388
6 SASI_Hs01_00132875 predicted 1598
7 SASI_Hs02_00371219 predicted 937
8 SASI_Hs01_00132876 predicted 626
9 SASI_Hs01_00132877 predicted 922
10 SASI_Hs02_00371220 predicted 1564
11 SASI_Hs01_00132871 predicted 995
12 SASI_Hs01_00132878 predicted 963
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024779 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202672 predicted 554
2 SASI_Rn01_00057245 predicted 872
3 SASI_Rn01_00057246 predicted 1416
4 SASI_Rn01_00057247 predicted 889
5 SASI_Rn01_00057248 predicted 838
6 SASI_Rn01_00057249 predicted 1456
7 SASI_Rn01_00057250 predicted 1606
8 SASI_Rn01_00057251 predicted 801
9 SASI_Rn01_00057253 predicted 757
10 SASI_Rn01_00057254 predicted 1632
11 SASI_Rn01_00057252 predicted 1519
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027816 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332763 predicted 386
2 SASI_Mm02_00332764 predicted 904
3 SASI_Mm02_00332765 predicted 654
4 SASI_Mm02_00332766 predicted 1665
5 SASI_Mm02_00332767 predicted 550
6 SASI_Mm02_00332768 predicted 1576
7 SASI_Mm02_00332769 predicted 1430
8 SASI_Mm02_00332770 predicted 1375
9 SASI_Mm02_00332771 predicted 912
10 SASI_Mm02_00332772 predicted 553
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_131188 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00215453 predicted 638
2 SASI_Mm01_00215454 predicted 1147
3 SASI_Mm01_00215455 predicted 1181
4 SASI_Mm01_00215456 predicted 906
5 SASI_Mm01_00215457 predicted 1821
6 SASI_Mm01_00215458 predicted 1677
7 SASI_Mm01_00215459 predicted 1624
8 SASI_Mm01_00215460 predicted 1154
9 SASI_Mm01_00215461 predicted 808
10 SASI_Mm01_00215462 predicted 804
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183075
VALIDATED
CYP2U1 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 2, subfamily U, polypeptide 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183075.2-1623s21c1
Sequence:CCGGGCTTTACCTGAGGATTCTAAGCTCGAGCTTAGAATCCTCAGGTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183075.2-1490s21c1
Sequence:CCGGTGACCAAGGACAACTAATTAACTCGAGTTAATTAGTTGTCCTTGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414075    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183075.2-2084s21c1
Sequence:CCGGAGCACTAATGATGGTCAAATGCTCGAGCATTTGACCATCATTAGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183075.2-626s21c1
Sequence:CCGGTCATTCAACTCTTCGTCATTTCTCGAGAAATGACGAAGAGTTGAATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183075.2-367s21c1
Sequence:CCGGGGATTGATCCCTCGGTCATAGCTCGAGCTATGACCGAGGGATCAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183075.2-1659s21c1
Sequence:CCGGGGAAGATTTGGTCTAACTTTACTCGAGTAAAGTTAGACCAAATCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_183075.1-1131s1c1
Sequence:CCGGCCTGCTGTATATGTCGCTGAACTCGAGTTCAGCGACATATACAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_183075.1-753s1c1
Sequence:CCGGCCAGCGCTTTGATTACACTAACTCGAGTTAGTGTAATCAAAGCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183075.1-1384s1c1
Sequence:CCGGGTACATAGAGACCCAGCCATTCTCGAGAATGGCTGGGTCTCTATGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183075.1-878s1c1
Sequence:CCGGCCTTTGGACCATTTAAGGAATCTCGAGATTCCTTAAATGGTCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183075
VALIDATED
CYP2U1 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 2, subfamily U, polypeptide 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183075.2-1623s21c1
Sequence:CCGGGCTTTACCTGAGGATTCTAAGCTCGAGCTTAGAATCCTCAGGTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183075.2-1490s21c1
Sequence:CCGGTGACCAAGGACAACTAATTAACTCGAGTTAATTAGTTGTCCTTGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414075    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183075.2-2084s21c1
Sequence:CCGGAGCACTAATGATGGTCAAATGCTCGAGCATTTGACCATCATTAGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183075.2-626s21c1
Sequence:CCGGTCATTCAACTCTTCGTCATTTCTCGAGAAATGACGAAGAGTTGAATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183075.2-367s21c1
Sequence:CCGGGGATTGATCCCTCGGTCATAGCTCGAGCTATGACCGAGGGATCAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183075.2-1659s21c1
Sequence:CCGGGGAAGATTTGGTCTAACTTTACTCGAGTAAAGTTAGACCAAATCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_183075.1-1131s1c1
Sequence:CCGGCCTGCTGTATATGTCGCTGAACTCGAGTTCAGCGACATATACAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_183075.1-753s1c1
Sequence:CCGGCCAGCGCTTTGATTACACTAACTCGAGTTAGTGTAATCAAAGCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183075.1-1384s1c1
Sequence:CCGGGTACATAGAGACCCAGCCATTCTCGAGAATGGCTGGGTCTCTATGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183075.1-878s1c1
Sequence:CCGGCCTTTGGACCATTTAAGGAATCTCGAGATTCCTTAAATGGTCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183075
VALIDATED
CYP2U1 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 2, subfamily U, polypeptide 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183075.2-1623s21c1
Sequence:CCGGGCTTTACCTGAGGATTCTAAGCTCGAGCTTAGAATCCTCAGGTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183075.2-1490s21c1
Sequence:CCGGTGACCAAGGACAACTAATTAACTCGAGTTAATTAGTTGTCCTTGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414075    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183075.2-2084s21c1
Sequence:CCGGAGCACTAATGATGGTCAAATGCTCGAGCATTTGACCATCATTAGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183075.2-626s21c1
Sequence:CCGGTCATTCAACTCTTCGTCATTTCTCGAGAAATGACGAAGAGTTGAATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183075.2-367s21c1
Sequence:CCGGGGATTGATCCCTCGGTCATAGCTCGAGCTATGACCGAGGGATCAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183075.2-1659s21c1
Sequence:CCGGGGAAGATTTGGTCTAACTTTACTCGAGTAAAGTTAGACCAAATCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_183075.1-1131s1c1
Sequence:CCGGCCTGCTGTATATGTCGCTGAACTCGAGTTCAGCGACATATACAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_183075.1-753s1c1
Sequence:CCGGCCAGCGCTTTGATTACACTAACTCGAGTTAGTGTAATCAAAGCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183075.1-1384s1c1
Sequence:CCGGGTACATAGAGACCCAGCCATTCTCGAGAATGGCTGGGTCTCTATGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183075.1-878s1c1
Sequence:CCGGCCTTTGGACCATTTAAGGAATCTCGAGATTCCTTAAATGGTCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027816
CYP2U1 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 2, subfamily U, polypeptide 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027816.3-558s21c1
Sequence:CCGGTTGCACACTATGGTCCAATTTCTCGAGAAATTGGACCATAGTGTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027816.3-1439s21c1
Sequence:CCGGGACTTCTGTCCTCATCGATTTCTCGAGAAATCGATGAGGACAGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027816.3-601s21c1
Sequence:CCGGCCACTCGACGCTTCGTCATTTCTCGAGAAATGACGAAGCGTCGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252815    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027816.3-2073s21c1
Sequence:CCGGGATGTAGGTCTAGGTTATATTCTCGAGAATATAACCTAGACCTACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027816.3-855s21c1
Sequence:CCGGAGCTCTTCCTGATCAACATATCTCGAGATATGTTGATCAGGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027816
CYP2U1 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 2, subfamily U, polypeptide 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027816.3-558s21c1
Sequence:CCGGTTGCACACTATGGTCCAATTTCTCGAGAAATTGGACCATAGTGTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027816.3-1439s21c1
Sequence:CCGGGACTTCTGTCCTCATCGATTTCTCGAGAAATCGATGAGGACAGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027816.3-601s21c1
Sequence:CCGGCCACTCGACGCTTCGTCATTTCTCGAGAAATGACGAAGCGTCGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252815    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027816.3-2073s21c1
Sequence:CCGGGATGTAGGTCTAGGTTATATTCTCGAGAATATAACCTAGACCTACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027816.3-855s21c1
Sequence:CCGGAGCTCTTCCTGATCAACATATCTCGAGATATGTTGATCAGGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027816
CYP2U1 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 2, subfamily U, polypeptide 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027816.3-558s21c1
Sequence:CCGGTTGCACACTATGGTCCAATTTCTCGAGAAATTGGACCATAGTGTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027816.3-1439s21c1
Sequence:CCGGGACTTCTGTCCTCATCGATTTCTCGAGAAATCGATGAGGACAGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027816.3-601s21c1
Sequence:CCGGCCACTCGACGCTTCGTCATTTCTCGAGAAATGACGAAGCGTCGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252815    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027816.3-2073s21c1
Sequence:CCGGGATGTAGGTCTAGGTTATATTCTCGAGAATATAACCTAGACCTACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027816.3-855s21c1
Sequence:CCGGAGCTCTTCCTGATCAACATATCTCGAGATATGTTGATCAGGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks