EMAIL THIS PAGE TO A FRIEND

CYP2W1

cytochrome P450, family 2, subfamily W, polypeptide 1

85 Gene Product Result for
UniProtKB ID: Q8TAV3
Gene ID:
Human(54905) Summary: This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. [provided by RefSeq, Jul 2008]
Mouse(545817) cytochrome P450, family 2, subfamily w, polypeptide 1
Rat(288517) cytochrome P450, family 2, subfamily w, polypeptide 1
chicken(416453) cytochrome P450, family 2, subfamily W, polypeptide 1
chicken(416454) cytochrome P450, family 2, subfamily W, polypeptide 1
dog(491601) cytochrome P450, family 2, subfamily W, polypeptide 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017781 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017781 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017781 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001160265 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001160265 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001160265 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU207391 MISSION® esiRNA esiRNA targeting mouse Cyp2w1 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017781 Rosetta Predictions human pricing
XM_001074391 Rosetta Predictions rat pricing
XM_221971 Rosetta Predictions rat pricing
XM_001481321 Rosetta Predictions mouse pricing
XM_620268 Rosetta Predictions mouse pricing
XR_005014 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017781 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117348 predicted 1226
2 SASI_Hs01_00117349 predicted 1229
3 SASI_Hs01_00117350 predicted 1246
4 SASI_Hs01_00117351 predicted 658
5 SASI_Hs01_00117352 predicted 1927
6 SASI_Hs01_00117353 predicted 1928
7 SASI_Hs01_00117354 predicted 1249
8 SASI_Hs01_00117355 predicted 1251
9 SASI_Hs01_00117356 predicted 1851
10 SASI_Hs01_00117357 predicted 306
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074391 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00346040 predicted 592
2 SASI_Rn02_00346041 predicted 223
3 SASI_Rn02_00346042 predicted 812
4 SASI_Rn02_00346043 predicted 857
5 SASI_Rn02_00346044 predicted 270
6 SASI_Rn02_00346045 predicted 778
7 SASI_Rn02_00346046 predicted 575
8 SASI_Rn02_00346047 predicted 1232
9 SASI_Rn02_00346048 predicted 398
10 SASI_Rn02_00346049 predicted 946
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221971 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380478 predicted 657
2 SASI_Rn02_00380479 predicted 651
3 SASI_Rn02_00380480 predicted 814
4 SASI_Rn02_00380481 predicted 855
5 SASI_Rn02_00380482 predicted 1149
6 SASI_Rn02_00380483 predicted 774
7 SASI_Rn02_00380484 predicted 945
8 SASI_Rn02_00380485 predicted 636
9 SASI_Rn02_00380486 predicted 869
10 SASI_Rn02_00380487 predicted 722
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001481321 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00423696 predicted 1019
2 SASI_Mm02_00423697 predicted 700
3 SASI_Mm02_00423698 predicted 273
4 SASI_Mm02_00423699 predicted 493
5 SASI_Mm02_00423700 predicted 498
6 SASI_Mm02_00423701 predicted 700
7 SASI_Mm02_00423702 predicted 716
8 SASI_Mm02_00423703 predicted 1072
9 SASI_Mm02_00423704 predicted 559
10 SASI_Mm02_00423705 predicted 584
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_620268 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00427596 predicted 316
2 SASI_Mm02_00427597 predicted 399
3 SASI_Mm02_00427598 predicted 537
4 SASI_Mm02_00427599 predicted 387
5 SASI_Mm02_00427600 predicted 338
6 SASI_Mm02_00427601 predicted 344
7 SASI_Mm02_00427602 predicted 350
8 SASI_Mm02_00427603 predicted 394
9 SASI_Mm02_00427604 predicted 305
10 SASI_Mm02_00427605 predicted 519
11 SASI_Mm01_00231134 predicted 1193
12 SASI_Mm01_00231135 predicted 873
13 SASI_Mm01_00231136 predicted 869
14 SASI_Mm01_00231137 predicted 884
15 SASI_Mm01_00231138 predicted 1243
16 SASI_Mm01_00231139 predicted 871
17 SASI_Mm01_00231140 predicted 904
18 SASI_Mm01_00231141 predicted 892
19 SASI_Mm01_00231142 predicted 1198
20 SASI_Mm01_00231143 predicted 1075
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_005014 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00282612 predicted 707
2 SASI_Mm01_00282613 predicted 653
3 SASI_Mm01_00282614 predicted 791
4 SASI_Mm01_00282615 predicted 727
5 SASI_Mm01_00282616 predicted 654
6 SASI_Mm01_00282617 predicted 790
7 SASI_Mm01_00282618 predicted 793
8 SASI_Mm01_00282619 predicted 734
9 SASI_Mm01_00282620 predicted 725
10 SASI_Mm01_00282621 predicted 651
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017781
CYP2W1 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 2, subfamily W, polypeptide 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017781.1-1075s1c1
Sequence:CCGGCGGCCATTTCCTGGACGCGAACTCGAGTTCGCGTCCAGGAAATGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017781.1-886s1c1
Sequence:CCGGGCCCTACACAAGCGCCGTGCTCTCGAGAGCACGGCGCTTGTGTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017781.1-1227s1c1
Sequence:CCGGCACCTCCTGATCTCAGGTTCTCTCGAGAGAACCTGAGATCAGGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017781.1-409s1c1
Sequence:CCGGCCGCCGATTTGACTACCGGGACTCGAGTCCCGGTAGTCAAATCGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017781.2-1627s21c1
Sequence:CCGGTCAGCAACTGCTTCCGGTTACCTCGAGGTAACCGGAAGCAGTTGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017781.2-459s21c1
Sequence:CCGGAGGAGCTGAAATGCCTCTCTGCTCGAGCAGAGAGGCATTTCAGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017781.2-543s21c1
Sequence:CCGGATATCACCTTCGCGCTCCTCTCTCGAGAGAGGAGCGCGAAGGTGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017781.2-610s21c1
Sequence:CCGGGGGTCTCATCGATGAGGTCATCTCGAGATGACCTCATCGATGAGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017781
CYP2W1 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 2, subfamily W, polypeptide 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017781.1-1075s1c1
Sequence:CCGGCGGCCATTTCCTGGACGCGAACTCGAGTTCGCGTCCAGGAAATGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017781.1-886s1c1
Sequence:CCGGGCCCTACACAAGCGCCGTGCTCTCGAGAGCACGGCGCTTGTGTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017781.1-1227s1c1
Sequence:CCGGCACCTCCTGATCTCAGGTTCTCTCGAGAGAACCTGAGATCAGGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017781.1-409s1c1
Sequence:CCGGCCGCCGATTTGACTACCGGGACTCGAGTCCCGGTAGTCAAATCGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017781.2-1627s21c1
Sequence:CCGGTCAGCAACTGCTTCCGGTTACCTCGAGGTAACCGGAAGCAGTTGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017781.2-459s21c1
Sequence:CCGGAGGAGCTGAAATGCCTCTCTGCTCGAGCAGAGAGGCATTTCAGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017781.2-543s21c1
Sequence:CCGGATATCACCTTCGCGCTCCTCTCTCGAGAGAGGAGCGCGAAGGTGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017781.2-610s21c1
Sequence:CCGGGGGTCTCATCGATGAGGTCATCTCGAGATGACCTCATCGATGAGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017781
CYP2W1 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 2, subfamily W, polypeptide 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017781.1-1075s1c1
Sequence:CCGGCGGCCATTTCCTGGACGCGAACTCGAGTTCGCGTCCAGGAAATGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017781.1-886s1c1
Sequence:CCGGGCCCTACACAAGCGCCGTGCTCTCGAGAGCACGGCGCTTGTGTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017781.1-1227s1c1
Sequence:CCGGCACCTCCTGATCTCAGGTTCTCTCGAGAGAACCTGAGATCAGGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017781.1-409s1c1
Sequence:CCGGCCGCCGATTTGACTACCGGGACTCGAGTCCCGGTAGTCAAATCGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017781.2-1627s21c1
Sequence:CCGGTCAGCAACTGCTTCCGGTTACCTCGAGGTAACCGGAAGCAGTTGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017781.2-459s21c1
Sequence:CCGGAGGAGCTGAAATGCCTCTCTGCTCGAGCAGAGAGGCATTTCAGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017781.2-543s21c1
Sequence:CCGGATATCACCTTCGCGCTCCTCTCTCGAGAGAGGAGCGCGAAGGTGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017781.2-610s21c1
Sequence:CCGGGGGTCTCATCGATGAGGTCATCTCGAGATGACCTCATCGATGAGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001160265
CYP2W1 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 2, subfamily W, polypeptide 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000347470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160265.1-863s21c1
Sequence:CCGGATGACCCTGAGGACATGTTTGCTCGAGCAAACATGTCCTCAGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160265.1-626s21c1
Sequence:CCGGTGTCCCTGCTGAGTCTCATTGCTCGAGCAATGAGACTCAGCAGGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160265.1-961s21c1
Sequence:CCGGGCCGTCTTCCTGATGGTTAAGCTCGAGCTTAACCATCAGGAAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160265.1-669s21c1
Sequence:CCGGGTCACCTGGCATACAGCTATTCTCGAGAATAGCTGTATGCCAGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001160265
CYP2W1 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 2, subfamily W, polypeptide 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000347470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160265.1-863s21c1
Sequence:CCGGATGACCCTGAGGACATGTTTGCTCGAGCAAACATGTCCTCAGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160265.1-626s21c1
Sequence:CCGGTGTCCCTGCTGAGTCTCATTGCTCGAGCAATGAGACTCAGCAGGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160265.1-961s21c1
Sequence:CCGGGCCGTCTTCCTGATGGTTAAGCTCGAGCTTAACCATCAGGAAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160265.1-669s21c1
Sequence:CCGGGTCACCTGGCATACAGCTATTCTCGAGAATAGCTGTATGCCAGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001160265
CYP2W1 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 2, subfamily W, polypeptide 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000347470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160265.1-863s21c1
Sequence:CCGGATGACCCTGAGGACATGTTTGCTCGAGCAAACATGTCCTCAGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160265.1-626s21c1
Sequence:CCGGTGTCCCTGCTGAGTCTCATTGCTCGAGCAATGAGACTCAGCAGGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160265.1-961s21c1
Sequence:CCGGGCCGTCTTCCTGATGGTTAAGCTCGAGCTTAACCATCAGGAAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160265.1-669s21c1
Sequence:CCGGGTCACCTGGCATACAGCTATTCTCGAGAATAGCTGTATGCCAGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks