EMAIL THIS PAGE TO A FRIEND

CYP39A1

cytochrome P450, family 39, subfamily A, polypeptide 1

99 Gene Product Result for
UniProtKB ID: Q9NYL5, Q5VTT0, Q96FW5
Gene ID:
Human(51302) Summary: This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum protein is involved in the conversion of cholesterol to bile acids. Its substrates include the oxysterols 25-hydroxycholesterol, 27-hydroxycholesterol and 24-hydroxycholesterol. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Mouse(56050) cytochrome P450, family 39, subfamily a, polypeptide 1
Rat(301264) cytochrome P450, family 39, subfamily a, polypeptide 1
Zebrafish(564475) cytochrome P450, family 39, subfamily A, polypeptide 1
chicken(422058) cytochrome P450, family 39, subfamily A, polypeptide 1
cow(511195) cytochrome P450, family 39, subfamily A, polypeptide 1
dog(481825) cytochrome P450, family 39, subfamily A, polypeptide 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016593 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016593 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016593 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018887 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018887 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018887 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016593 Rosetta Predictions human pricing
NM_001106893 Rosetta Predictions rat pricing
NM_018887 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016593 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179320 predicted 1509
2 SASI_Hs01_00179321 predicted 660
3 SASI_Hs01_00179322 predicted 1522
4 SASI_Hs01_00179323 predicted 590
5 SASI_Hs01_00179324 predicted 1312
6 SASI_Hs01_00179325 predicted 1180
7 SASI_Hs01_00179326 predicted 373
8 SASI_Hs02_00349725 predicted 1392
9 SASI_Hs01_00179327 predicted 1353
10 SASI_Hs01_00179328 predicted 1532
11 SASI_Hs01_00179329 predicted 1591
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106893 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223446 predicted 1479
2 SASI_Rn02_00223447 predicted 775
3 SASI_Rn02_00223448 predicted 532
4 SASI_Rn02_00223449 predicted 1580
5 SASI_Rn02_00223450 predicted 563
6 SASI_Rn02_00223451 predicted 1298
7 SASI_Rn02_00223452 predicted 1692
8 SASI_Rn02_00223453 predicted 1697
9 SASI_Rn02_00223454 predicted 565
10 SASI_Rn02_00223455 predicted 496
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018887 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105102 predicted 1451
2 SASI_Mm01_00105103 predicted 1680
3 SASI_Mm01_00105104 predicted 406
4 SASI_Mm01_00105105 predicted 1058
5 SASI_Mm01_00105106 predicted 960
6 SASI_Mm01_00105107 predicted 757
7 SASI_Mm02_00324306 predicted 1443
8 SASI_Mm01_00105108 predicted 1515
9 SASI_Mm01_00105109 predicted 778
10 SASI_Mm01_00105110 predicted 731
11 SASI_Mm01_00105101 predicted 1357
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016593
VALIDATED
CYP39A1 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 39, subfamily A, polypeptide 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016593.3-943s21c1
Sequence:CCGGTTGCAAGCTACGCTGGATATTCTCGAGAATATCCAGCGTAGCTTGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419135    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016593.3-2088s21c1
Sequence:CCGGGGAACTCCTAGGCTCTATTAACTCGAGTTAATAGAGCCTAGGAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016593.3-1348s1c1
Sequence:CCGGCCTGAATTGTTCAAACCTGAACTCGAGTTCAGGTTTGAACAATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016593.3-504s1c1
Sequence:CCGGCGTTTATCGTACAGCATCAATCTCGAGATTGATGCTGTACGATAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016593.3-1167s1c1
Sequence:CCGGCCTGGAGAATCTCCTTCTAATCTCGAGATTAGAAGGAGATTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016593.3-1395s1c1
Sequence:CCGGGCACTCTTTCTTGGACTGCTTCTCGAGAAGCAGTCCAAGAAAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016593.3-374s1c1
Sequence:CCGGGAATCAAGTATGGACCAATATCTCGAGATATTGGTCCATACTTGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016593
VALIDATED
CYP39A1 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 39, subfamily A, polypeptide 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016593.3-943s21c1
Sequence:CCGGTTGCAAGCTACGCTGGATATTCTCGAGAATATCCAGCGTAGCTTGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419135    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016593.3-2088s21c1
Sequence:CCGGGGAACTCCTAGGCTCTATTAACTCGAGTTAATAGAGCCTAGGAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016593.3-1348s1c1
Sequence:CCGGCCTGAATTGTTCAAACCTGAACTCGAGTTCAGGTTTGAACAATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016593.3-504s1c1
Sequence:CCGGCGTTTATCGTACAGCATCAATCTCGAGATTGATGCTGTACGATAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016593.3-1167s1c1
Sequence:CCGGCCTGGAGAATCTCCTTCTAATCTCGAGATTAGAAGGAGATTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016593.3-1395s1c1
Sequence:CCGGGCACTCTTTCTTGGACTGCTTCTCGAGAAGCAGTCCAAGAAAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016593.3-374s1c1
Sequence:CCGGGAATCAAGTATGGACCAATATCTCGAGATATTGGTCCATACTTGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016593
VALIDATED
CYP39A1 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 39, subfamily A, polypeptide 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016593.3-943s21c1
Sequence:CCGGTTGCAAGCTACGCTGGATATTCTCGAGAATATCCAGCGTAGCTTGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419135    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016593.3-2088s21c1
Sequence:CCGGGGAACTCCTAGGCTCTATTAACTCGAGTTAATAGAGCCTAGGAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016593.3-1348s1c1
Sequence:CCGGCCTGAATTGTTCAAACCTGAACTCGAGTTCAGGTTTGAACAATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016593.3-504s1c1
Sequence:CCGGCGTTTATCGTACAGCATCAATCTCGAGATTGATGCTGTACGATAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016593.3-1167s1c1
Sequence:CCGGCCTGGAGAATCTCCTTCTAATCTCGAGATTAGAAGGAGATTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016593.3-1395s1c1
Sequence:CCGGGCACTCTTTCTTGGACTGCTTCTCGAGAAGCAGTCCAAGAAAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016593.3-374s1c1
Sequence:CCGGGAATCAAGTATGGACCAATATCTCGAGATATTGGTCCATACTTGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018887
VALIDATED
CYP39A1 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 39, subfamily A, polypeptide 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000329413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018887.3-1445s21c1
Sequence:CCGGGCTCTCTTAGAGATTCAACTACTCGAGTAGTTGAATCTCTAAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216220    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018887.3-1032s1c1
Sequence:CCGGCATTCTGGACACTTGGATATACTCGAGTATATCCAAGTGTCCAGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018887.3-1033s21c1
Sequence:CCGGATTCTGGACACTTGGATATATCTCGAGATATATCCAAGTGTCCAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018887.3-428s21c1
Sequence:CCGGGAAGAAGGAATCAATGTGCTTCTCGAGAAGCACATTGATTCCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353556    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018887.3-2015s21c1
Sequence:CCGGCTTGGAAATCTTAGGCTTATTCTCGAGAATAAGCCTAAGATTTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018887.3-963s21c1
Sequence:CCGGCACGTCAATACAGTCCAAATTCTCGAGAATTTGGACTGTATTGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018887.2-1570s1c1
Sequence:CCGGGCCGGATTGAATATAAACAAACTCGAGTTTGTTTATATTCAATCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018887.2-429s1c1
Sequence:CCGGGAAGAAGGAATCAATGTGCTTCTCGAGAAGCACATTGATTCCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018887.2-1446s1c1
Sequence:CCGGGCTCTCTTAGAGATTCAACTACTCGAGTAGTTGAATCTCTAAGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018887.2-1468s1c1
Sequence:CCGGGCATTATCTTAGTGCTGTATACTCGAGTATACAGCACTAAGATAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194209    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018887.2-2304s1c1
Sequence:CCGGGCAGTCTCATTATGTCTGGTTCTCGAGAACCAGACATAATGAGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018887
VALIDATED
CYP39A1 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 39, subfamily A, polypeptide 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000329413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018887.3-1445s21c1
Sequence:CCGGGCTCTCTTAGAGATTCAACTACTCGAGTAGTTGAATCTCTAAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216220    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018887.3-1032s1c1
Sequence:CCGGCATTCTGGACACTTGGATATACTCGAGTATATCCAAGTGTCCAGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018887.3-1033s21c1
Sequence:CCGGATTCTGGACACTTGGATATATCTCGAGATATATCCAAGTGTCCAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018887.3-428s21c1
Sequence:CCGGGAAGAAGGAATCAATGTGCTTCTCGAGAAGCACATTGATTCCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353556    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018887.3-2015s21c1
Sequence:CCGGCTTGGAAATCTTAGGCTTATTCTCGAGAATAAGCCTAAGATTTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018887.3-963s21c1
Sequence:CCGGCACGTCAATACAGTCCAAATTCTCGAGAATTTGGACTGTATTGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018887.2-1570s1c1
Sequence:CCGGGCCGGATTGAATATAAACAAACTCGAGTTTGTTTATATTCAATCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018887.2-429s1c1
Sequence:CCGGGAAGAAGGAATCAATGTGCTTCTCGAGAAGCACATTGATTCCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018887.2-1446s1c1
Sequence:CCGGGCTCTCTTAGAGATTCAACTACTCGAGTAGTTGAATCTCTAAGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018887.2-1468s1c1
Sequence:CCGGGCATTATCTTAGTGCTGTATACTCGAGTATACAGCACTAAGATAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194209    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018887.2-2304s1c1
Sequence:CCGGGCAGTCTCATTATGTCTGGTTCTCGAGAACCAGACATAATGAGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018887
VALIDATED
CYP39A1 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 39, subfamily A, polypeptide 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000329413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018887.3-1445s21c1
Sequence:CCGGGCTCTCTTAGAGATTCAACTACTCGAGTAGTTGAATCTCTAAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216220    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018887.3-1032s1c1
Sequence:CCGGCATTCTGGACACTTGGATATACTCGAGTATATCCAAGTGTCCAGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018887.3-1033s21c1
Sequence:CCGGATTCTGGACACTTGGATATATCTCGAGATATATCCAAGTGTCCAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018887.3-428s21c1
Sequence:CCGGGAAGAAGGAATCAATGTGCTTCTCGAGAAGCACATTGATTCCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353556    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018887.3-2015s21c1
Sequence:CCGGCTTGGAAATCTTAGGCTTATTCTCGAGAATAAGCCTAAGATTTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018887.3-963s21c1
Sequence:CCGGCACGTCAATACAGTCCAAATTCTCGAGAATTTGGACTGTATTGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018887.2-1570s1c1
Sequence:CCGGGCCGGATTGAATATAAACAAACTCGAGTTTGTTTATATTCAATCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018887.2-429s1c1
Sequence:CCGGGAAGAAGGAATCAATGTGCTTCTCGAGAAGCACATTGATTCCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018887.2-1446s1c1
Sequence:CCGGGCTCTCTTAGAGATTCAACTACTCGAGTAGTTGAATCTCTAAGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018887.2-1468s1c1
Sequence:CCGGGCATTATCTTAGTGCTGTATACTCGAGTATACAGCACTAAGATAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194209    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018887.2-2304s1c1
Sequence:CCGGGCAGTCTCATTATGTCTGGTTCTCGAGAACCAGACATAATGAGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks