EMAIL THIS PAGE TO A FRIEND

CYP3A43

cytochrome P450, family 3, subfamily A, polypeptide 43

Species: Human CYP3A43(64816)
UniProtKB ID: Q9HB55, Q75MK2, Q9HB52, Q9HB53, Q9HB54, Q9HB57
Gene ID:
Human(64816) Summary: This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. The encoded protein has a low level of testosterone hydroxylase activity, and may play a role in aging mechanisms and cancer progression. This gene is part of a cluster of cytochrome P450 genes on chromosome 7q21.1. Alternate splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
74 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0045 AQUA Peptide LQEEIDAVLPN[K] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022820 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022820 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022820 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022820 Rosetta Predictions human pricing
NM_057095 Rosetta Predictions human pricing
NM_057096 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022820 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224593 predicted 662
2 SASI_Hs01_00224594 predicted 805
3 SASI_Hs02_00356121 predicted 849
4 SASI_Hs01_00224596 predicted 640
5 SASI_Hs02_00356122 predicted 416
6 SASI_Hs02_00356123 predicted 539
7 SASI_Hs01_00224599 predicted 602
8 SASI_Hs01_00224600 predicted 636
9 SASI_Hs01_00224601 predicted 756
10 SASI_Hs01_00224602 predicted 414
11 SASI_Hs01_00224595 predicted 903
12 SASI_Hs01_00224597 predicted 589
13 SASI_Hs01_00224598 predicted 990
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057095 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120232 predicted 664
2 SASI_Hs01_00120233 predicted 805
3 SASI_Hs02_00362005 predicted 850
4 SASI_Hs01_00120235 predicted 638
5 SASI_Hs02_00362006 predicted 412
6 SASI_Hs02_00362007 predicted 534
7 SASI_Hs01_00120238 predicted 599
8 SASI_Hs01_00120239 predicted 636
9 SASI_Hs01_00120240 predicted 756
10 SASI_Hs01_00120241 predicted 420
11 SASI_Hs01_00120234 predicted 903
12 SASI_Hs01_00120236 predicted 598
13 SASI_Hs01_00120237 predicted 994
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057096 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033862 predicted 668
2 SASI_Hs01_00033863 predicted 800
3 SASI_Hs02_00362008 predicted 855
4 SASI_Hs01_00033865 predicted 643
5 SASI_Hs02_00362009 predicted 413
6 SASI_Hs02_00362010 predicted 542
7 SASI_Hs01_00033868 predicted 604
8 SASI_Hs01_00033869 predicted 636
9 SASI_Hs01_00033870 predicted 757
10 SASI_Hs01_00033871 predicted 415
11 SASI_Hs01_00033864 predicted 903
12 SASI_Hs01_00033866 predicted 591
13 SASI_Hs01_00033867 predicted 990
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022820
CYP3A43 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 3, subfamily A, polypeptide 43
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022820.3-648s21c1
Sequence:CCGGATGTAATCACTGGCACATTATCTCGAGATAATGTGCCAGTGATTACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423887    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022820.3-1820s21c1
Sequence:CCGGTGACAAATCAATGCCAAATAACTCGAGTTATTTGGCATTGATTTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022820.3-1348s1c1
Sequence:CCGGCCCTGAAAGTAGGTTCAGTAACTCGAGTTACTGAACCTACTTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022820.3-945s1c1
Sequence:CCGGCCAAAGAAACAAAGTCCCATACTCGAGTATGGGACTTTGTTTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022820.3-156s1c1
Sequence:CCGGGCCTGGTACTCCTCTATATTTCTCGAGAAATATAGAGGAGTACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022820.3-1526s1c1
Sequence:CCGGCCACTGAAATTAGACAATCTACTCGAGTAGATTGTCTAATTTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022820.3-1280s1c1
Sequence:CCGGGCAGTGATGGTTCCAATCTATCTCGAGATAGATTGGAACCATCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022820
CYP3A43 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 3, subfamily A, polypeptide 43
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022820.3-648s21c1
Sequence:CCGGATGTAATCACTGGCACATTATCTCGAGATAATGTGCCAGTGATTACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423887    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022820.3-1820s21c1
Sequence:CCGGTGACAAATCAATGCCAAATAACTCGAGTTATTTGGCATTGATTTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022820.3-1348s1c1
Sequence:CCGGCCCTGAAAGTAGGTTCAGTAACTCGAGTTACTGAACCTACTTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022820.3-945s1c1
Sequence:CCGGCCAAAGAAACAAAGTCCCATACTCGAGTATGGGACTTTGTTTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022820.3-156s1c1
Sequence:CCGGGCCTGGTACTCCTCTATATTTCTCGAGAAATATAGAGGAGTACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022820.3-1526s1c1
Sequence:CCGGCCACTGAAATTAGACAATCTACTCGAGTAGATTGTCTAATTTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022820.3-1280s1c1
Sequence:CCGGGCAGTGATGGTTCCAATCTATCTCGAGATAGATTGGAACCATCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022820
CYP3A43 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 3, subfamily A, polypeptide 43
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022820.3-648s21c1
Sequence:CCGGATGTAATCACTGGCACATTATCTCGAGATAATGTGCCAGTGATTACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423887    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022820.3-1820s21c1
Sequence:CCGGTGACAAATCAATGCCAAATAACTCGAGTTATTTGGCATTGATTTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022820.3-1348s1c1
Sequence:CCGGCCCTGAAAGTAGGTTCAGTAACTCGAGTTACTGAACCTACTTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022820.3-945s1c1
Sequence:CCGGCCAAAGAAACAAAGTCCCATACTCGAGTATGGGACTTTGTTTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022820.3-156s1c1
Sequence:CCGGGCCTGGTACTCCTCTATATTTCTCGAGAAATATAGAGGAGTACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022820.3-1526s1c1
Sequence:CCGGCCACTGAAATTAGACAATCTACTCGAGTAGATTGTCTAATTTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022820.3-1280s1c1
Sequence:CCGGGCAGTGATGGTTCCAATCTATCTCGAGATAGATTGGAACCATCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks