EMAIL THIS PAGE TO A FRIEND

CYP3A4

cytochrome P450, family 3, subfamily A, polypeptide 4

66 Gene Product Result for
Synonyms: CP33 CP34 CYP3A CYP3A3 CYPIIIA3 CYPIIIA4 HLP NF-25 P450C3 P450PCN1
UniProtKB ID: P08684, P05184, Q16757, Q9UK50
Gene ID:
Human(1576) Summary: This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases that catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and its expression is induced by glucocorticoids and some pharmacological agents. This enzyme is involved in the metabolism of approximately half the drugs in use today, including acetaminophen, codeine, cyclosporin A, diazepam and erythromycin. The enzyme also metabolizes some steroids and carcinogens. This gene is part of a cluster of cytochrome P450 genes on chromosome 7q21.1. Previously another CYP3A gene, CYP3A3, was thought to exist; however, it is now thought that this sequence represents a transcript variant of CYP3A4. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Feb 2011]
chicken(416477) cytochrome P450, family 3, subfamily A, polypeptide 4
Horse(100294525) cytochrome P450, subfamily IIIA (niphedipine oxidase), polypeptide 4
dog(479740) cytochrome P450, family 3, subfamily A, polypeptide 4
cow(507988) cytochrome P450, subfamily IIIA, polypeptide 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
01338 Bergamottin analytical standard human pricing
P49007 Piperine ≥97% human pricing
W290904 Piperine ≥97%, FG human pricing
S8307 SB 203580 solid, ≥98% (HPLC) human pricing
C6019 Clotrimazole human, mouse pricing
33894 Clotrimazole VETRANAL, analytical standard human, mouse pricing
C3915 Colchicine BioReagent, plant cell culture tested, ≥95% (HPLC) human, mouse pricing
C9754 Colchicine ≥95% (HPLC), powder human, mouse pricing
E6376 Erythromycin potency: ≥850 μg per mg human, mouse pricing
E5389 Erythromycin BioReagent, suitable for cell culture human, mouse pricing
45674 Erythromycin tested according to Ph.Eur. human, mouse pricing
E0774 Erythromycin meets USP testing specifications human, mouse pricing
E7904 Erythromycin Biotechnology Performance Certified human, mouse pricing
I8898 Ivermectin human, mouse pricing
B7005 Betamethasone ≥98% human, mouse, rat pricing
34166 Betamethasone VETRANAL, analytical standard human, mouse, rat pricing
B9675 Betamethasone meets USP testing specifications human, mouse, rat pricing
C4522 Cimetidine human, mouse, rat pricing
D1756 Dexamethasone ≥98% (HPLC), powder human, mouse, rat pricing
D4902 Dexamethasone powder, BioReagent, suitable for cell culture, ≥97% human, mouse, rat pricing
D8893 Dexamethasone powder, γ-irradiated, BioXtra, suitable for cell culture, ≥80% (HPLC) human, mouse, rat pricing
D9184 Dexamethasone meets USP testing specifications human, mouse, rat pricing
46165 Dexamethasone VETRANAL, analytical standard human, mouse, rat pricing
31375 Dexamethasone tested according to Ph.Eur. human, mouse, rat pricing
D6003 Digoxin analytical standard human, mouse, rat pricing
D6770 Digoxin analytical standard human, mouse, rat pricing
E1383 Etoposide synthetic, ≥98%, powder human, mouse, rat pricing
H4001 Hydrocortisone ≥98% (HPLC) human, mouse, rat pricing
H0135 Hydrocortisone γ-irradiated, powder, BioXtra, suitable for cell culture human, mouse, rat pricing
H0888 Hydrocortisone BioReagent, suitable for cell culture human, mouse, rat pricing
H3160 Hydrocortisone meets USP testing specifications human, mouse, rat pricing
H6909 Hydrocortisone solution 50 μM, sterile-filtered, BioXtra, suitable for cell culture human, mouse, rat pricing
H0396 Hydrocortisone-Water Soluble BioReagent, suitable for cell culture human, mouse, rat pricing
K1003 Ketoconazole ≥98% (HPLC) human, mouse, rat pricing
UC280 Ketoconazole human, mouse, rat pricing
UC429 Midazolam hydrochloride solid human, mouse, rat pricing
P1793 Pimozide human, mouse, rat pricing
Q3625 Quinidine anhydrous human, mouse, rat pricing
22600 Quinidine crystallized, ≥98.0% (dried material, NT) human, mouse, rat pricing
T9652 Terfenadine human, mouse, rat pricing
L9664 Loratadine ≥98% (HPLC), powder human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017460 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017460 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017460 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017460 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017460 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164397 predicted 1594
2 SASI_Hs01_00164399 predicted 1521
3 SASI_Hs01_00164400 predicted 1712
4 SASI_Hs01_00164402 predicted 815
5 SASI_Hs01_00164403 predicted 1687
6 SASI_Hs01_00164398 predicted 1347
7 SASI_Hs01_00164401 predicted 1349
8 SASI_Hs01_00164396 predicted 1663
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017460
CYP3A4 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 3, subfamily A, polypeptide 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017460.3-824s1c1
Sequence:CCGGGTTTCCAAGAGAAGTTACAAACTCGAGTTTGTAACTTCTCTTGGAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017460.3-791s1c1
Sequence:CCGGCATCCCAATTCTTGAAGTATTCTCGAGAATACTTCAAGAATTGGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017460.3-1349s1c1
Sequence:CCGGCCCTGAAAGATTCAGCAAGAACTCGAGTTCTTGCTGAATCTTTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017460.3-181s1c1
Sequence:CCGGGAACCCATTCACATGGACTTTCTCGAGAAAGTCCATGTGAATGGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017460.3-1137s1c1
Sequence:CCGGCCCACCTATGATACTGTGCTACTCGAGTAGCACAGTATCATAGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436334    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017460.3-1913s21c1
Sequence:CCGGCTGATAAGAGAATCAACATTTCTCGAGAAATGTTGATTCTCTTATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017460.3-879s21c1
Sequence:CCGGAGTCGCCTCGAAGATACACAACTCGAGTTGTGTATCTTCGAGGCGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417816    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017460.3-1852s21c1
Sequence:CCGGTCTGCTTCTCACGGGACTATTCTCGAGAATAGTCCCGTGAGAAGCAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017460
CYP3A4 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 3, subfamily A, polypeptide 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017460.3-824s1c1
Sequence:CCGGGTTTCCAAGAGAAGTTACAAACTCGAGTTTGTAACTTCTCTTGGAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017460.3-791s1c1
Sequence:CCGGCATCCCAATTCTTGAAGTATTCTCGAGAATACTTCAAGAATTGGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017460.3-1349s1c1
Sequence:CCGGCCCTGAAAGATTCAGCAAGAACTCGAGTTCTTGCTGAATCTTTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017460.3-181s1c1
Sequence:CCGGGAACCCATTCACATGGACTTTCTCGAGAAAGTCCATGTGAATGGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017460.3-1137s1c1
Sequence:CCGGCCCACCTATGATACTGTGCTACTCGAGTAGCACAGTATCATAGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436334    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017460.3-1913s21c1
Sequence:CCGGCTGATAAGAGAATCAACATTTCTCGAGAAATGTTGATTCTCTTATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017460.3-879s21c1
Sequence:CCGGAGTCGCCTCGAAGATACACAACTCGAGTTGTGTATCTTCGAGGCGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417816    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017460.3-1852s21c1
Sequence:CCGGTCTGCTTCTCACGGGACTATTCTCGAGAATAGTCCCGTGAGAAGCAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017460
CYP3A4 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 3, subfamily A, polypeptide 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017460.3-824s1c1
Sequence:CCGGGTTTCCAAGAGAAGTTACAAACTCGAGTTTGTAACTTCTCTTGGAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017460.3-791s1c1
Sequence:CCGGCATCCCAATTCTTGAAGTATTCTCGAGAATACTTCAAGAATTGGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017460.3-1349s1c1
Sequence:CCGGCCCTGAAAGATTCAGCAAGAACTCGAGTTCTTGCTGAATCTTTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017460.3-181s1c1
Sequence:CCGGGAACCCATTCACATGGACTTTCTCGAGAAAGTCCATGTGAATGGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017460.3-1137s1c1
Sequence:CCGGCCCACCTATGATACTGTGCTACTCGAGTAGCACAGTATCATAGGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436334    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017460.3-1913s21c1
Sequence:CCGGCTGATAAGAGAATCAACATTTCTCGAGAAATGTTGATTCTCTTATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017460.3-879s21c1
Sequence:CCGGAGTCGCCTCGAAGATACACAACTCGAGTTGTGTATCTTCGAGGCGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417816    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017460.3-1852s21c1
Sequence:CCGGTCTGCTTCTCACGGGACTATTCTCGAGAATAGTCCCGTGAGAAGCAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)