EMAIL THIS PAGE TO A FRIEND

CYP3A7

cytochrome P450, family 3, subfamily A, polypeptide 7

15 Gene Product Result for
Synonyms: CP37 CYPIIIA7 P450-HFLA
Species: Human CYP3A7(1551), chicken CYP3A7(414832)
UniProtKB ID: P24462, A4D288
Gene ID:
Human(1551) Summary: This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This enzyme hydroxylates testosterone and dehydroepiandrosterone 3-sulphate, which is involved in the formation of estriol during pregnancy. The enzyme also metabolizes some drugs such as aflatoxin B1. This gene is part of a cluster of cytochrome P450 genes on chromosome 7q21.1. Transcript variants have been described, but it is not known whether these transcripts are normally produced. This gene undergoes readthrough transcription with the downstream CYP3AP1 pseudogene, resulting in an isoform with a novel C-terminus, as represented in GeneID:100861540. [provided by RefSeq, Feb 2012]
chicken(414832) cytochrome P450 A 37
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0105 AQUA Peptide SLLSPTFTSG[K] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000765 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000765 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000765 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000765 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000765 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214598 predicted 322
2 SASI_Hs01_00214599 predicted 1669
3 SASI_Hs01_00214600 predicted 269
4 SASI_Hs01_00214601 predicted 114
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000765
CYP3A7 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 3, subfamily A, polypeptide 7
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000765.2-265s1c1
Sequence:CCGGCGTAAGGGCTATTGGACGTTTCTCGAGAAACGTCCAATAGCCCTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000765.2-1347s1c1
Sequence:CCGGCCTCCCTGAAAGGTTCAGTAACTCGAGTTACTGAACCTTTCAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000765.2-248s1c1
Sequence:CCGGGAAATGCTTTGTCCTTCCGTACTCGAGTACGGAAGGACAAAGCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000765.2-1538s1c1
Sequence:CCGGGCTTTGGAGGACTTCTTCTAACTCGAGTTAGAAGAAGTCCTCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000765.2-1390s1c1
Sequence:CCGGCCTTACATATACACACCCTTTCTCGAGAAAGGGTGTGTATATGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000765
CYP3A7 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 3, subfamily A, polypeptide 7
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000765.2-265s1c1
Sequence:CCGGCGTAAGGGCTATTGGACGTTTCTCGAGAAACGTCCAATAGCCCTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000765.2-1347s1c1
Sequence:CCGGCCTCCCTGAAAGGTTCAGTAACTCGAGTTACTGAACCTTTCAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000765.2-248s1c1
Sequence:CCGGGAAATGCTTTGTCCTTCCGTACTCGAGTACGGAAGGACAAAGCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000765.2-1538s1c1
Sequence:CCGGGCTTTGGAGGACTTCTTCTAACTCGAGTTAGAAGAAGTCCTCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000765.2-1390s1c1
Sequence:CCGGCCTTACATATACACACCCTTTCTCGAGAAAGGGTGTGTATATGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000765
CYP3A7 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 3, subfamily A, polypeptide 7
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000765.2-265s1c1
Sequence:CCGGCGTAAGGGCTATTGGACGTTTCTCGAGAAACGTCCAATAGCCCTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000765.2-1347s1c1
Sequence:CCGGCCTCCCTGAAAGGTTCAGTAACTCGAGTTACTGAACCTTTCAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000765.2-248s1c1
Sequence:CCGGGAAATGCTTTGTCCTTCCGTACTCGAGTACGGAAGGACAAAGCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000765.2-1538s1c1
Sequence:CCGGGCTTTGGAGGACTTCTTCTAACTCGAGTTAGAAGAAGTCCTCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000765.2-1390s1c1
Sequence:CCGGCCTTACATATACACACCCTTTCTCGAGAAAGGGTGTGTATATGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks