EMAIL THIS PAGE TO A FRIEND

CYP46A1

cytochrome P450, family 46, subfamily A, polypeptide 1

123 Gene Product Result for
Synonyms: CP46 CYP46
UniProtKB ID: Q9Y6A2
Gene ID:
Human(10858) Summary: This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum protein is expressed in the brain, where it converts cholesterol to 24S-hydroxycholesterol. While cholesterol cannot pass the blood-brain barrier, 24S-hydroxycholesterol can be secreted in the brain into the circulation to be returned to the liver for catabolism. [provided by RefSeq, Jul 2008]
Mouse(13116) cytochrome P450, family 46, subfamily a, polypeptide 1
Rat(362782) cytochrome P450, family 46, subfamily a, polypeptide 1
Zebrafish(553543) cytochrome P450, family 46, subfamily A, polypeptide 1
cow(506438) cytochrome P450, family 46, subfamily A, polypeptide 1
dog(480432) cytochrome P450, family 46, subfamily A, polypeptide 1
chicken(423450) cytochrome P450, family 46, subfamily A, polypeptide 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006668 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006668 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006668 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010010 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010010 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010010 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006668 Rosetta Predictions human pricing
NM_001108723 Rosetta Predictions rat pricing
NM_010010 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006668 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342061 predicted 930
2 SASI_Hs01_00051847 predicted 998
3 SASI_Hs01_00051849 predicted 329
4 SASI_Hs02_00342062 predicted 284
5 SASI_Hs01_00051850 predicted 922
6 SASI_Hs01_00051852 predicted 266
7 SASI_Hs01_00051853 predicted 990
8 SASI_Hs01_00051855 predicted 1337
9 SASI_Hs01_00051856 predicted 656
10 SASI_Hs02_00342063 predicted 733
11 SASI_Hs01_00051848 predicted 445
12 SASI_Hs01_00051851 predicted 407
13 SASI_Hs01_00051854 predicted 831
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108723 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241445 predicted 1063
2 SASI_Rn02_00241446 predicted 1078
3 SASI_Rn02_00241447 predicted 815
4 SASI_Rn02_00241448 predicted 1329
5 SASI_Rn02_00241449 predicted 1556
6 SASI_Rn02_00241450 predicted 1301
7 SASI_Rn02_00241451 predicted 2199
8 SASI_Rn02_00241452 predicted 992
9 SASI_Rn02_00241453 predicted 785
10 SASI_Rn02_00241454 predicted 720
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010010 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059583 predicted 264
2 SASI_Mm01_00059584 predicted 1215
3 SASI_Mm01_00059585 predicted 738
4 SASI_Mm01_00059586 predicted 985
5 SASI_Mm01_00059588 predicted 1267
6 SASI_Mm01_00059589 predicted 1229
7 SASI_Mm01_00059590 predicted 1021
8 SASI_Mm02_00317615 predicted 1332
9 SASI_Mm01_00059592 predicted 249
10 SASI_Mm02_00317616 predicted 1254
11 SASI_Mm01_00059587 predicted 1395
12 SASI_Mm01_00059591 predicted 345
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006668
CYP46A1 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 46, subfamily A, polypeptide 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006668.1-446s1c1
Sequence:CCGGCCTTGGTTAGCTTAATGGAAACTCGAGTTTCCATTAAGCTAACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006668.1-817s1c1
Sequence:CCGGGCCGACATCCTCACACAGATTCTCGAGAATCTGTGTGAGGATGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006668.1-1323s1c1
Sequence:CCGGGTTTGCTCAGATGGAGGTGAACTCGAGTTCACCTCCATCTGAGCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006668.1-202s1c1
Sequence:CCGGGCTAAGAAGTATGGACCTGTTCTCGAGAACAGGTCCATACTTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006668.1-404s21c1
Sequence:CCGGACAAGCAGCGGAGAGTCATAGCTCGAGCTATGACTCTCCGCTGCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006668.1-374s21c1
Sequence:CCGGTGGTGTCCGAATGCAACTATGCTCGAGCATAGTTGCATTCGGACACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006668
CYP46A1 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 46, subfamily A, polypeptide 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006668.1-446s1c1
Sequence:CCGGCCTTGGTTAGCTTAATGGAAACTCGAGTTTCCATTAAGCTAACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006668.1-817s1c1
Sequence:CCGGGCCGACATCCTCACACAGATTCTCGAGAATCTGTGTGAGGATGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006668.1-1323s1c1
Sequence:CCGGGTTTGCTCAGATGGAGGTGAACTCGAGTTCACCTCCATCTGAGCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006668.1-202s1c1
Sequence:CCGGGCTAAGAAGTATGGACCTGTTCTCGAGAACAGGTCCATACTTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006668.1-404s21c1
Sequence:CCGGACAAGCAGCGGAGAGTCATAGCTCGAGCTATGACTCTCCGCTGCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006668.1-374s21c1
Sequence:CCGGTGGTGTCCGAATGCAACTATGCTCGAGCATAGTTGCATTCGGACACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006668
CYP46A1 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 46, subfamily A, polypeptide 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006668.1-446s1c1
Sequence:CCGGCCTTGGTTAGCTTAATGGAAACTCGAGTTTCCATTAAGCTAACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006668.1-817s1c1
Sequence:CCGGGCCGACATCCTCACACAGATTCTCGAGAATCTGTGTGAGGATGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006668.1-1323s1c1
Sequence:CCGGGTTTGCTCAGATGGAGGTGAACTCGAGTTCACCTCCATCTGAGCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006668.1-202s1c1
Sequence:CCGGGCTAAGAAGTATGGACCTGTTCTCGAGAACAGGTCCATACTTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006668.1-404s21c1
Sequence:CCGGACAAGCAGCGGAGAGTCATAGCTCGAGCTATGACTCTCCGCTGCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006668.1-374s21c1
Sequence:CCGGTGGTGTCCGAATGCAACTATGCTCGAGCATAGTTGCATTCGGACACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010010
CYP46A1 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 46, subfamily A, polypeptide 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124844    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010010.1-1963s1c1
Sequence:CCGGCCACACTGTATTGTGAATGTTCTCGAGAACATTCACAATACAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010010.1-941s1c1
Sequence:CCGGGCTGGACAACTTTGTCACCTTCTCGAGAAGGTGACAAAGTTGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010010.1-254s1c1
Sequence:CCGGGTTTCTGGATTGGGCTAAGAACTCGAGTTCTTAGCCCAATCCAGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010010.1-437s1c1
Sequence:CCGGCTTGGTGTCTGAATGTGACTACTCGAGTAGTCACATTCAGACACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010010.1-473s1c1
Sequence:CCGGGCAGAGGAAAGTCATGGACTTCTCGAGAAGTCCATGACTTTCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010010
CYP46A1 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 46, subfamily A, polypeptide 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124844    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010010.1-1963s1c1
Sequence:CCGGCCACACTGTATTGTGAATGTTCTCGAGAACATTCACAATACAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010010.1-941s1c1
Sequence:CCGGGCTGGACAACTTTGTCACCTTCTCGAGAAGGTGACAAAGTTGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010010.1-254s1c1
Sequence:CCGGGTTTCTGGATTGGGCTAAGAACTCGAGTTCTTAGCCCAATCCAGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010010.1-437s1c1
Sequence:CCGGCTTGGTGTCTGAATGTGACTACTCGAGTAGTCACATTCAGACACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010010.1-473s1c1
Sequence:CCGGGCAGAGGAAAGTCATGGACTTCTCGAGAAGTCCATGACTTTCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010010
CYP46A1 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 46, subfamily A, polypeptide 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124844    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010010.1-1963s1c1
Sequence:CCGGCCACACTGTATTGTGAATGTTCTCGAGAACATTCACAATACAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010010.1-941s1c1
Sequence:CCGGGCTGGACAACTTTGTCACCTTCTCGAGAAGGTGACAAAGTTGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010010.1-254s1c1
Sequence:CCGGGTTTCTGGATTGGGCTAAGAACTCGAGTTCTTAGCCCAATCCAGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010010.1-437s1c1
Sequence:CCGGCTTGGTGTCTGAATGTGACTACTCGAGTAGTCACATTCAGACACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010010.1-473s1c1
Sequence:CCGGGCAGAGGAAAGTCATGGACTTCTCGAGAAGTCCATGACTTTCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks