EMAIL THIS PAGE TO A FRIEND

CYP4A11

cytochrome P450, family 4, subfamily A, polypeptide 11

12 Gene Product Result for
Synonyms: CP4Y CYP4A2 CYP4AII
Gene ID:
Human(1579) Summary: This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and hydroxylates medium-chain fatty acids such as laurate and myristate. [provided by RefSeq, Jul 2008]
dog(610385) cytochrome P450, family 4, subfamily A, polypeptide 11
cow(511890) cytochrome P450, family 4, subfamily A, polypeptide 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000778 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000778 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000778 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU127581 MISSION® esiRNA esiRNA human CYP4A11 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000778 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000778 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165514 predicted 745
2 SASI_Hs01_00165515 predicted 747
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000778
CYP4A11 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 4, subfamily A, polypeptide 11
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000179008    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000778.2-1686s1c1
Sequence:CCGGCGGGAAACAATTTGCCATGAACTCGAGTTCATGGCAAATTGTTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147049    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_000778.2-2473s1c1
Sequence:CCGGCCACCTGTTTCTTTGTTTGATCTCGAGATCAAACAAAGAAACAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000778.3-739s21c1
Sequence:CCGGTCCCGTGTGAGGAATGCCTTTCTCGAGAAAGGCATTCCTCACACGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244739    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000778.3-2071s21c1
Sequence:CCGGCTTGCTCTCCCAGGATCAATTCTCGAGAATTGATCCTGGGAGAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000778.3-85s21c1
Sequence:CCGGCTGGGTGATGTCTCTGGAATCCTCGAGGATTCCAGAGACATCACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000778.3-760s21c1
Sequence:CCGGCACCAGAATGACACCATCTACCTCGAGGTAGATGGTGTCATTCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000778.3-277s21c1
Sequence:CCGGCAGAAATGGGTGGAGACATTCCTCGAGGAATGTCTCCACCCATTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000778
CYP4A11 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 4, subfamily A, polypeptide 11
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000179008    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000778.2-1686s1c1
Sequence:CCGGCGGGAAACAATTTGCCATGAACTCGAGTTCATGGCAAATTGTTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147049    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_000778.2-2473s1c1
Sequence:CCGGCCACCTGTTTCTTTGTTTGATCTCGAGATCAAACAAAGAAACAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000778.3-739s21c1
Sequence:CCGGTCCCGTGTGAGGAATGCCTTTCTCGAGAAAGGCATTCCTCACACGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244739    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000778.3-2071s21c1
Sequence:CCGGCTTGCTCTCCCAGGATCAATTCTCGAGAATTGATCCTGGGAGAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000778.3-85s21c1
Sequence:CCGGCTGGGTGATGTCTCTGGAATCCTCGAGGATTCCAGAGACATCACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000778.3-760s21c1
Sequence:CCGGCACCAGAATGACACCATCTACCTCGAGGTAGATGGTGTCATTCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000778.3-277s21c1
Sequence:CCGGCAGAAATGGGTGGAGACATTCCTCGAGGAATGTCTCCACCCATTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000778
CYP4A11 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 4, subfamily A, polypeptide 11
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000179008    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000778.2-1686s1c1
Sequence:CCGGCGGGAAACAATTTGCCATGAACTCGAGTTCATGGCAAATTGTTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147049    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_000778.2-2473s1c1
Sequence:CCGGCCACCTGTTTCTTTGTTTGATCTCGAGATCAAACAAAGAAACAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000778.3-739s21c1
Sequence:CCGGTCCCGTGTGAGGAATGCCTTTCTCGAGAAAGGCATTCCTCACACGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244739    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000778.3-2071s21c1
Sequence:CCGGCTTGCTCTCCCAGGATCAATTCTCGAGAATTGATCCTGGGAGAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000778.3-85s21c1
Sequence:CCGGCTGGGTGATGTCTCTGGAATCCTCGAGGATTCCAGAGACATCACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000778.3-760s21c1
Sequence:CCGGCACCAGAATGACACCATCTACCTCGAGGTAGATGGTGTCATTCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000778.3-277s21c1
Sequence:CCGGCAGAAATGGGTGGAGACATTCCTCGAGGAATGTCTCCACCCATTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks