EMAIL THIS PAGE TO A FRIEND

CYP4A22

cytochrome P450, family 4, subfamily A, polypeptide 22

11 Gene Product Result for
UniProtKB ID: Q5TCH4, Q5TCH3, Q6JXK7, Q6JXK8, Q9NRM4
Gene ID:
Human(284541) Summary: This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This gene is part of a cluster of cytochrome P450 genes on chromosome 1p33. [provided by RefSeq, Jul 2008]
cow(516085) cytochrome P450, family 4, subfamily A, polypeptide 22
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV41861 Anti-CYP4A22 antibody produced in rabbit affinity isolated antibody bovine, human
immunohistochemistry, western blot pricing
SAB2104824 Anti-CYP4A22, (N-terminal) antibody produced in rabbit affinity isolated antibody human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_208213 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_208213 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_208213 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU105451 MISSION® esiRNA esiRNA human CYP4A22 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010969 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010969 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136556 predicted 261
2 SASI_Hs01_00136557 predicted 738
3 SASI_Hs01_00136558 predicted 738
4 SASI_Hs01_00136559 predicted 107
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_208213
CYP4A22 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 4, subfamily A, polypeptide 22
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208213.3-616s1c1
Sequence:CCGGCCTGACTATATGAAGGTGATTCTCGAGAATCACCTTCATATAGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208213.3-1000s1c1
Sequence:CCGGTGCTGTATGAGGAATGCCTTTCTCGAGAAAGGCATTCCTCATACAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208213.3-1789s1c1
Sequence:CCGGCGACTTGTGTTGAAATCCAAACTCGAGTTTGGATTTCAACACAAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208213.3-1149s1c1
Sequence:CCGGGCTGGAGAAGATCAAGAGGAACTCGAGTTCCTCTTGATCTTCTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208213.3-1686s1c1
Sequence:CCGGCGGGAAACAATTTGCCATGAACTCGAGTTCATGGCAAATTGTTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_208213
CYP4A22 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 4, subfamily A, polypeptide 22
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208213.3-616s1c1
Sequence:CCGGCCTGACTATATGAAGGTGATTCTCGAGAATCACCTTCATATAGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208213.3-1000s1c1
Sequence:CCGGTGCTGTATGAGGAATGCCTTTCTCGAGAAAGGCATTCCTCATACAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208213.3-1789s1c1
Sequence:CCGGCGACTTGTGTTGAAATCCAAACTCGAGTTTGGATTTCAACACAAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208213.3-1149s1c1
Sequence:CCGGGCTGGAGAAGATCAAGAGGAACTCGAGTTCCTCTTGATCTTCTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208213.3-1686s1c1
Sequence:CCGGCGGGAAACAATTTGCCATGAACTCGAGTTCATGGCAAATTGTTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_208213
CYP4A22 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 4, subfamily A, polypeptide 22
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208213.3-616s1c1
Sequence:CCGGCCTGACTATATGAAGGTGATTCTCGAGAATCACCTTCATATAGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208213.3-1000s1c1
Sequence:CCGGTGCTGTATGAGGAATGCCTTTCTCGAGAAAGGCATTCCTCATACAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208213.3-1789s1c1
Sequence:CCGGCGACTTGTGTTGAAATCCAAACTCGAGTTTGGATTTCAACACAAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208213.3-1149s1c1
Sequence:CCGGGCTGGAGAAGATCAAGAGGAACTCGAGTTCCTCTTGATCTTCTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208213.3-1686s1c1
Sequence:CCGGCGGGAAACAATTTGCCATGAACTCGAGTTCATGGCAAATTGTTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks